
Bio::Grep::Benchmarks - Bio::Grep Benchmarks

A collection of quick and dirty benchmarks.

4 x Intel(R) Core(TM)2 Quad CPU Q9400 @ 2.66GHz, 4GB RAM. Fedora Linux 2.6.27.38-170.2.113.fc10.i686.PAE (kernel: 2.6.27.38-170.2.113.fc10.i686.PAE). Perl 5.10.0.0.
TAIR8_cdna_20080412 (Arabidopsis CDNA Fasta file, 63MB).
Bio::Grep 0.10.6.
Average over 2 iterations.
GUUGle : 2.88 sec Agrep/RE : 10.69 sec Vmatch (-pl 3) : 135.32 sec
Query: ugacagaagagagugagcac (revcom)
Average over 20 iterations.
Vmatch : 0.02 sec Agrep (Wu-Manber): 0.22 sec RE : 1.66 sec Vmatch (-online) : 3.80 sec GUUGle : 6.18 sec Agrep (TRE) : 10.22 sec
Note that Vmatch needs one slow run to load the suffix arrays in memory (Values are the average over 20 iterations). Also note that GUUGle allows GU mismatches.
Vmatch : 0.05 sec Agrep (Wu-Manber): 0.98 sec Vmatch (-online) : 3.85 sec Agrep (TRE) : 35.26 sec GUUGle : n/a RE : n/a
Vmatch : 0.12 sec Agrep (Wu-Manber): 1.28 sec Vmatch (-online) : 3.89 sec Agrep (TRE) : 43.48 sec GUUGle : n/a RE : n/a
Vmatch : 0.28 sec Agrep (Wu-Manber): 1.57 sec Vmatch (-online) : 4.01 sec Agrep (TRE) : 50.66 sec GUUGle : n/a RE : n/a
Vmatch : 0.93 sec Agrep (Wu-Manber): 1.89 sec Vmatch (-online) : 4.48 sec Agrep (TRE) : 57.43 sec GUUGle : n/a RE : n/a
Agrep (Wu-Manber): 2.42 sec Vmatch : 3.95 sec Vmatch (-online) : 6.85 sec Agrep (TRE) : 64.81 sec GUUGle : n/a RE : n/a

The script that generated these benchmarks is available in the examples directory of this distribution.
Please report any bugs, feature requests and benchmarks to bug-bio-grep@rt.cpan.org, or through the web interface at http://rt.cpan.org.

Markus Riester, <mriester@gmx.de>

Copyright (C) 2007-2009 M. Riester.
This module is free software; you can redistribute it and/or modify it under the same terms as Perl itself.