LIMAONE > Bio-Grep > Bio::Grep::Benchmarks

Download:
Bio-Grep-v0.10.6.tar.gz

Annotate this POD

CPAN RT

New  1
Open  0
View/Report Bugs
Source  

NAME ^

Bio::Grep::Benchmarks - Bio::Grep Benchmarks

DESCRIPTION ^

A collection of quick and dirty benchmarks.

BENCHMARKS ^

4 x Intel(R) Core(TM)2 Quad CPU Q9400 @ 2.66GHz, 4GB RAM. Fedora Linux 2.6.27.38-170.2.113.fc10.i686.PAE (kernel: 2.6.27.38-170.2.113.fc10.i686.PAE). Perl 5.10.0.0.

TAIR8_cdna_20080412 (Arabidopsis CDNA Fasta file, 63MB).

Bio::Grep 0.10.6.

Database Generation

Average over 2 iterations.

  GUUGle         : 2.88 sec
  Agrep/RE       : 10.69 sec
  Vmatch (-pl 3) : 135.32 sec

Mismatches

Query: ugacagaagagagugagcac (revcom)

Average over 20 iterations.

No mismatches (exact matching):
  Vmatch           :  0.02 sec
  Agrep (Wu-Manber):  0.22 sec
  RE               :  1.66 sec
  Vmatch (-online) :  3.80 sec
  GUUGle           :  6.18 sec
  Agrep (TRE)      : 10.22 sec

Note that Vmatch needs one slow run to load the suffix arrays in memory (Values are the average over 20 iterations). Also note that GUUGle allows GU mismatches.

One mismatch:
  Vmatch           :  0.05 sec
  Agrep (Wu-Manber):  0.98 sec
  Vmatch (-online) :  3.85 sec
  Agrep (TRE)      : 35.26 sec
  GUUGle           :       n/a
  RE               :       n/a
Two mismatches:
  Vmatch           :  0.12 sec
  Agrep (Wu-Manber):  1.28 sec
  Vmatch (-online) :  3.89 sec
  Agrep (TRE)      : 43.48 sec
  GUUGle           :       n/a
  RE               :       n/a
Three mismatches:
  Vmatch           :  0.28 sec
  Agrep (Wu-Manber):  1.57 sec
  Vmatch (-online) :  4.01 sec
  Agrep (TRE)      : 50.66 sec
  GUUGle           :       n/a
  RE               :       n/a
Four mismatches:
  Vmatch           :  0.93 sec
  Agrep (Wu-Manber):  1.89 sec
  Vmatch (-online) :  4.48 sec
  Agrep (TRE)      : 57.43 sec
  GUUGle           :       n/a
  RE               :       n/a
Five mismatches:
  Agrep (Wu-Manber):  2.42 sec
  Vmatch           :  3.95 sec
  Vmatch (-online) :  6.85 sec
  Agrep (TRE)      : 64.81 sec
  GUUGle           :       n/a
  RE               :       n/a

FEEDBACK ^

The script that generated these benchmarks is available in the examples directory of this distribution.

Please report any bugs, feature requests and benchmarks to bug-bio-grep@rt.cpan.org, or through the web interface at http://rt.cpan.org.

AUTHOR ^

Markus Riester, <mriester@gmx.de>

LICENSE AND COPYRIGHT ^

Copyright (C) 2007-2009 M. Riester.

This module is free software; you can redistribute it and/or modify it under the same terms as Perl itself.

syntax highlighting: