Arlin Stoltzfus > Bio-NEXUS > Tutorial


Annotate this POD


New  2
Open  3
View/Report Bugs


Tutorial - Hands-on tutorial for using Bio::NEXUS module.


Tutorial to get started using Bio::NEXUS module.


The NEXUS file format standard of Maddison, et al. (1997) is designed to represent sets of data, including character data (e.g., molecular sequence alignments, morphological character sets), trees, assumptions about models and methods, meta-information such as comments, and so on. Bio::NEXUS is an object-oriented Perl applications programming interface (API) for the NEXUS file format. Accordingly, Bio::NEXUS provides methods for managing character data, trees, assumptions, meta-information, and so on, via the NEXUS format.

This tutorial provides a quick introduction to developing applications that carry out basic manipulations with data sets in NEXUS files, as well as importing data sets from (and exporting to) foreign data formats (using BioPerl and Bio::NEXUS). You may wish to continue reading, and to complete the tutorial exercises, *if*

Structure of the tutorial

This tutorial is organised into seven sections:


Bio::NEXUS naturally requires Perl, but it does not require any non-standard Perl modules. To carry out the tutorial exercises below, you must have a UN*X (or UN*X work-alike or Windoze) shell, an installation of Perl, and an installation of Bio::NEXUS. For the format conversion exercises, you also need an installation of BioPerl (see, or simply run the command "perl -MCPAN -e'install Bundle::Bio'"). For the advanced exercise, there are additional requirements as described below. If you have tried to install these things and they do not work, the most likely cause is that you do not have permission to do the default system-wide installation, or that you have not issued the correct commands for a custom user-specific installation. See the Bio::NEXUS installation guide for further information.


The following are the conventions used in this tutorial.

Getting started with your UN*X shell, Perl, and Bio::NEXUS

Before getting started with Bio::NEXUS methods, begin by opening a terminal window and checking a few things using your shell (i.e., UNIX or UNIX-work-alike shell, or Windoze shell).

Basic manipulations with trees, OTU sets, and characters

Creating the example1.nex NEXUS file used in several exercises


For the first few exercises, we will use a sample NEXUS file with a taxa block, a characters block and a trees block. For this reason, please create a file named "example1.nex" from the following text:

       DIMENSIONS ntax=4;
       TAXLABELS  A B C D;
       DIMENSIONS ntax=4 nchar=25;
       FORMAT DATATYPE=protein;
       TREE my_tree = (((A:1,B:1):1,D:0.5):1,C:2)root;

Use the "cat" command to check the file (this should reproduce the text given above):

 system$ cat example1.nex

NEXUS files can have many different types of blocks. Each block has commands, e.g., the TAXA block has two possible commands, dimensions and taxlabels. Some further blocks and commands will be introduced in the examples below. A complete presentation of the NEXUS standard is given by Maddison, D.R., D.L. Swofford, and W.P. Maddison (1997), "NEXUS: an extendible file format for systematic information" (Systematic Biology 46: 590-621).

Renaming some or all OTU names


We often have the need to rename OTUs systematically for purposes of compatibility.

 use Bio::NEXUS;
 my %translate = ( 'A' => 'Human_gene', 'C' => 'Chimp_gene');
 my $nexus_obj=new Bio::NEXUS("example1.nex");
Commands and Output
 system$ perl
 system$ cat renamed.nex
        DIMENSIONS ntax=4;
        TAXLABELS  Human_gene B Chimp_gene D;
        DIMENSIONS ntax=4 nchar=25;
        TREE my_tree = (((Human_gene:1,B:1)inode2:1,D:0.5)inode1:1,Chimp_gene:2)root;

Above, the renaming was done using a hash with the old name as the keys and the new name as the values. With, you can create a file with lines of the form "oldName < space > newName" (e.g. "species1 Homo_sapiens") and then invoke the rename option with this file to change all of the names at once.

Removing one or more OTUs


A common need is to prune a data set by removing an OTU (e.g., an outlier, or a mis-classified sequence).

 use Bio::NEXUS;
 my $nexus_obj = new Bio::NEXUS('example1.nex');
 $nexus_obj = $nexus_obj->exclude_otus(['A']);
Commands and Output
 system$ perl
 system$ cat excluded.nex
        DIMENSIONS ntax=3;
        TAXLABELS  B C D;
        DIMENSIONS ntax=3 nchar=25;
        TREE my_tree = ((B:2,D:0.5)inode1:1,C:2)root;

In the above example, the OTU names for deletion are given as array reference argument to the exclude_otus method of Bio::NEXUS object.

Rerooting a tree on an outgroup (or a node)


An unrooted tree obtained from a tree-building program needs to be rooted based on the most distant OTU in the datset in order to identify a common ancestor or evolutionary path. Sometimes the root of a tree is inferred wrongly by tree-building programs, and hence has to be changed.

 use Bio::NEXUS;
 my $nexus_obj   = new Bio::NEXUS('example1.nex'); 
 $tree_obj       = $nexus_obj->get_block('trees')->get_tree();
 $nexus_obj      = $nexus_obj->reroot('A');
 $rerooted_tree  = $nexus_obj->get_block('trees')->get_tree();
 # Print the tree in newick format
 print "Given tree    : ",$tree_obj->as_string,"\n";
 print "Rerooted tree : ",$rerooted_tree->as_string,"\n";
Commands and Output
 system$ perl
 Given tree    : (((A:1,B:1)inode2:1,D:0.5)inode1:1,C:2)root;
 Rerooted tree : (A:0.5,(B:1,(D:0.5,C:3)inode1:1)inode2:0.5)root;

The above script takes a newick tree string and does rerooting on a particular node using reroot method in the tree object. The tree object belongs to Bio::NEXUS::Tree class. The full help for this module can be obtained by typing perldoc Bio::NEXUS::Tree command at the command-prompt.

Selecting OTUs in a particular subtree


We often need to analyze closely related taxa based on their relation in a tree.

 #  -- select_subtree of 'inode1'
 use Bio::NEXUS;
 my $nexus_obj  = new Bio::NEXUS('example1.nex')->select_subtree('inode1');
Commands and Output
 system$ perl
 system$ cat subtree_data.nex
        DIMENSIONS ntax=3;
        TAXLABELS  A B D;
        DIMENSIONS ntax=3 nchar=25;
        TREE my_tree = ((A:1,B:1)inode2:1,D:0.5)root;

The above script creates a truncated NEXUS file based on the selection of a set of OTUs based on the subtree. The internal node (inode) name for selection of the subtree is given as argument for the select_subtree method of the Bio::NEXUS object.

Excluding OTUs in a particular subtree


In some analyses we need to remove a clade of sequences, to determine the effect their presence had on an evolutionary analysis.

 #  -- exclude all the OTUs for the subtree of internal node 'inode1'
 use Bio::NEXUS;
 my $nexus_obj  = new Bio::NEXUS('example1.nex')->exclude_subtree('inode2');
Commands and Output
 system$ perl
 system$ cat exclude_subtree_data.nex
        DIMENSIONS ntax=2;
        TAXLABELS  D C;
        DIMENSIONS ntax=2 nchar=25;
        TREE my_tree = (D:1.5,C:2)root;

The above script removes the set of OTUs that are descended from a particular internal node.

Selecting a subset of OTUs from a NEXUS file


Sometimes we want to include only specific OTUs in an evolutionary analysis.

 #  -- select the OTUs A,B,D 
 use Bio::NEXUS;
 my $nexus_obj  = new Bio::NEXUS('example1.nex')->select_otus(['A','B','D']);
Commands and Output
 system$ perl
 system$ cat selected_data.nex
        DIMENSIONS ntax=3;
        TAXLABELS  A B D;
        DIMENSIONS ntax=3 nchar=25;
        TREE my_tree = ((A:1,B:1)inode2:1,D:0.5)inode1:1;

The above script selects a set of OTUs given as array reference argument to the select_otus method in the Bio::NEXUS object. Refer to perldoc Bio::NEXUS for more options.

Creating a NEXUS file from a NEWICK tree string


It is often required to convert NEWICK tree to NEXUS file since many phylogenetics programs take NEXUS file format as input.

 use Bio::NEXUS;
 ## Create an empty Trees Block, and then add a tree to it
 my $trees_block   = new Bio::NEXUS::TreesBlock('trees');
 $trees_block->add_tree_from_newick( "((A:1,B:1):1,C:2)", "my_tree");
 # Create new Bio::NEXUS object
 my $nexus_obj = new Bio::NEXUS;
Commands and Output
 system$ perl
 system$ cat my_new_file.nex
        DIMENSIONS ntax=3;
        TAXLABELS  A B C;
        TREE my_tree = ((A:1,B:1)inode2:1,C:2)root;

The above script is creates a NEXUS file from a newick tree string. A new treeblock object, $trees_block, is created and the tree string is loaded into the treesblock using the add_tree_from_newick method. Then, this treesblock is added to a new nexus object. The content of the nexus object then is written to a file using the write method. Read details about the methods in Bio::NEXUS::TreesBlock and Bio::NEXUS using the perdoc command.

Creating the example2.nex NEXUS file used below


The following is a very simple NEXUS file with one taxa block and one tree block.The tutorial in the next section uses this file as input.

Commands and Output
 system$ cat example2.nex
        DIMENSIONS ntax=4;
        TAXLABELS  A B C D;
         TREE my_tree1 = (((A,B),D),C);

Assigning length to some or all branches of a tree


It is often required to scale the length of branches based on the total length of the tree or assign default length to branches of trees to be parsed correctly by some phylogenetics programs.

 use Bio::NEXUS;
 my $nexus_obj = new Bio::NEXUS('example2.nex');
 my $tree      = $nexus_obj->get_block('Trees')->get_tree; # gets the first tree from the trees block
 foreach my $node (@{ $tree->get_nodes }) {
 print $tree->as_string,"\n";
Commands and Output
 system$ perl
 system$ cat modified.nex
        DIMENSIONS ntax=4;
        TAXLABELS  A B C D;
        TREE my_tree1 = (((A:1,B:1)inode3:1,D:1)inode2:1,C:1)root:1;

In the above tutorial, all the branch lengths in the tree are set to a value of 1.0. The get_nodes method called on the tree object is used to get the all the nodes from the tree as an array ref. As we iterate through the nodes, the length property of each of the node is set using set_length method.

Creating the example3.nex NEXUS file used below


The following NEXUS file with 2 blocks (TAXA, TREES) will be used in the section that follows. The trees block in this NEXUS file contains three trees with the names "my_tree1", "my_tree2", and "my_tree3", and the taxa block contains four taxa - A, B, C, D.

Commands and Output
 system$ cat example3.nex 
   DIMENSIONS ntax=4;
   TREE my_tree1 = (((A:1,B:1)inode1:1,D:5)inode2:1,C:2);
   TREE my_tree2 = (((A:0.1,B:0.2)inode1:4,D:0.5)inode2:6,C:0.8);
   TREE my_tree3 = ((A,B,D)inode1,C);

Writing out trees in NEXUS as newick tree string


Some programs may require a simple newick string as imput, rather than a NEXUS file.

 use Bio::NEXUS;
 my $nexus_obj  = new Bio::NEXUS('example3.nex');
 my $trees = $nexus_obj->get_block('Trees')->get_trees();
 foreach my $tree ( @$trees ) {
   # printing trees as newick string
    print "#-------";
    print $tree->get_name," ",$tree->as_string,"\n";
    print $tree->get_name," ",$tree->as_string_inodes_nameless,"\n";
 ## Note : my $tree = $tree_block->get_tree(); # the first tree in the tree block is obtained.
Commands and Output
 system$ perl
 my_tree1: (((A:1,B:1)inode1:1,D:5)inode2:1,C:2)root; 
 my_tree1: (((A:1,B:1):1,D:5):1,C:2); 
 my_tree2: (((A:0.1,B:0.2)inode1:4,D:0.5)inode2:6,C:0.8)root;
 my_tree2: (((A:0.1,B:0.2):4,D:0.5):6,C:0.8); 
 my_tree3: ((A,B,D)inode1,C)root;
 my_tree3: ((A,B,D),C);

Bootstrap (or branch support) values, if set, will also be output. They will appear in square brackets after the length of the associated branch.

Getting the children or parent or other attributes of an node.


It is often important to know the attributes of a nodes to know the their properties or links among them (using the childen nodes and parent node of a node).

Script -- get children of 'inode1'
 use Bio::NEXUS;
 my $nexus_obj  = new Bio::NEXUS('example3.nex');
 my $trees       = $nexus_obj->get_block('Trees')->get_trees; # gets all the trees from the trees block
 foreach my $tree (@{$trees} ) {
    print $tree->get_name,"\n";
    foreach my $node (@{$tree->get_nodes}) {
       if ($node->get_name eq 'inode1') {
          my @children = @{ $node->get_children };
          print "Children of inode1 : ";
          foreach my $child (@children) {
              print $child->get_name, " ";
          print "\n";
Commands and Output
 system$ perl
 Children of inode1 : A B
 Children of inode1 : A B 
 Children of inode1 : A B D 

Other methods will allow you to get the parent and siblings of a node, the length of the branch leading to it, its associated branch support value, whether it is a terminal node (OTU), and more. Refer to the documentations of Bio::NEXUS::Tree and Bio::NEXUS::Node modules using the perldoc command.

Creating the example4.nex NEXUS file used below


The following NEXUS file contains 4 blocks: a taxa block, 2 characters blocks, and a trees block. The first characters block has a datatype of protein and the second one has dna datatype. This file is used as input for the next section of the tutorial. Bio::NEXUS has extensive methods for manipulating multiple characters and trees block.

Commands and Output
 system$ cat example4.nex
        DIMENSIONS ntax=4;
        TAXLABELS  A B C D;
        TITLE protein;
        DIMENSIONS ntax=4 nchar=17
        FORMAT DATATYPE=protein;
        TITLE dna;
        DIMENSIONS ntax=4 nchar=51
        FORMAT DATATYPE=dna;
    A     atgcgagaattggtacatattcaaggtggtcaatgtggtaaccaaattggt
    B     atgagagagctcgttcacatccagggtggccagtgcggtaaccagatcggc
    C     atgagagaaatcgttcacgttcagggcggccaatgcggcaaccaaattggc
    D     atgagagaaatcgtccacgttcagggtggccagtgcggcaaccaaattggc
        TREE my_tree1 = (((A:1,B:1)inode1:1,D:5)inode2:1,C:2);

Selecting a set of columns from the character blocks


It often required to select or exclude a subset of characters in the characters block, perhaps based on conservation or number of missing or gap characters.

 #  -- select specified number of columns from character blocks
 use Bio::NEXUS;
 my $nexus_obj  = new Bio::NEXUS('example4.nex');
 $nexus_obj     = $nexus_obj->select_chars([(5..10)],'protein');
 $nexus_obj     = $nexus_obj->select_chars([(15..32)],'dna');
Commands and Output
 system$ perl
 system$ cat column_select.nex
        DIMENSIONS ntax=4;
        TAXLABELS  A B C D;
        TITLE protein;
        DIMENSIONS ntax=4 nchar=17;
         6 7 8 9 10 11;
        A       HIQGGQ
        D       HVQGGQ
        C       HVQGGQ
        B       HIQGGQ
        TITLE dna;
        DIMENSIONS ntax=4 nchar=51;
         16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33;
        A       catattcaaggtggtcaa
        D       cacgttcagggtggccag
        C       cacgttcagggcggccaa
        B       cacatccagggtggccag
        TREE my_tree1 = (((A:1,B:1)inode1:1,D:5)inode2:1,C:2)root;

The above script demonstrates Bio::NEXUS library's capability to manipulate the MATRIX data in the CHARACTERS block. The select_columns is very useful function for selecting only a range of columns from the characters block. The multiple characters blocks can be selected and manupulated using the unique TITLE command value. Please refer to perldoc Bio::NEXUS::Block, perldoc Bio::NEXUS and perldoc Bio::NEXUS::CharactersBlock for more details about the available methods in them. Note that it is the users responsibility to maintain the integrity of the data in this case, by applying select_columns to both the DNA and protein alignments, whereas when selecting or excluding taxa, data integrity is maintained automatically by altering each block approriately.

Converting to and from foreign formats using BioPerl

Converting NEXUS file to various alignment formats. (Requires Bio-Perl).


It is often required to convert NEXUS file to other alignment formats to be used as input in other phylogenetics and alignment programs.

 use Bio::AlignIO;
 use Bio::SimpleAlign;
 use Bio::NEXUS;
 my $nexus_obj=new Bio::NEXUS("example1.nex");
 my $aln = new Bio::SimpleAlign;
 foreach my $otu (@{$nexus_obj->get_block("characters")->get_otuset->get_otus}) {
   my $seq_str = $otu->get_seq_string;
   my $seq_id  = $otu->get_name;
   my $seq = Bio::LocatableSeq->new( -SEQ => $seq_str, -START => 1,
                         -END => length($seq_str), -ID => $seq_id, -STRAND => 0);
 my  $aln_out_phylip   = Bio::AlignIO->new( -file => ">prot_align.phy", -format => "phylip");
 my  $aln_out_clustalw = Bio::AlignIO->new( -file => ">prot_align.mfa", -format => "clustalw");
 # Creates the output_filename.mfa file in clustalw
Commands and Output
 system$ perl
 system$ cat prot_align.phy
  4 25

 system$ cat prot_align.mfa
 CLUSTAL W(1.81) multiple sequence alignment
                         .** :** *** ****:: . *::

The above scripts uses Bio-Perl's capability to convert the NEXUS file contents to various formats. the alingment formats supported by Bio-Perl are bl2seq, clustalw, emboss, fasta, maf, mase, mega, meme, msf, pfam, phylip, prodom, psi, selex, and stockholm. The NEXUS data handler in Bio-Perl is very basic and does not have much functionality. Refer to for more about the alignment formats supported by Bio-Perl.

Converting various alignment formats to NEXUS file.(Requires Bio-Perl module)


The output from various programs has to be converted to NEXUS file format to be used by phylogenetics and alignment programs.

 use Bio::AlignIO;
 use Bio::NEXUS;
 # 1. Open a new Bio::NEXUS object
 my $nexus_obj      = new Bio::NEXUS();
 # 2. Assign input file name
 my $input_filename = 'prot_align.mfa';
 # 3. Create a new CharactersBlock
 my $char_block     = new Bio::NEXUS::CharactersBlock('characters');
 my $block_title    = 'Protein';
 # 4. Read alignment file using Bioperl module - Bio::AlignIO 
 my $in           = new Bio::AlignIO(-file => $input_filename, '-format' => 'clustalw');
 my (@otus,$ntax,$nchar);
 # 5. The matrix of the Characters block is stored as an otuset (class Bio::NEXUS::TaxUnitSet).
 # in Bio::NEXUS module otuset is represented as an array of OTU units. 
 while ( my $aln = $in->next_aln() ) {
    $nchar = $aln->length;
    $ntax  = $aln->no_sequences;
    foreach my $seq ($aln->each_seq) {
        my @seq = split(//,$seq->seq);
        push @otus, new Bio::NEXUS::TaxUnit($seq->id,\@seq);
 my $otuset = new Bio::NEXUS::TaxUnitSet();
 # 6. set title and format commands for the characters block
Commands and Output
 system$ perl
 system$ cat nexus_align.nex
        DIMENSIONS ntax=4;
        TAXLABELS  A D C B;
        TITLE Protein;
        DIMENSIONS ntax=4 nchar=25;

The content of prot_align.mfa can be obtained from the previous section ( NOTE: There should NOT be any spaces BEFORE the taxon name or sequence id in the CLUSTALW format ). The above script requires Bio-Perl installation.


Convert TreeFam database content to NEXUS file [ Modules required: treefam, DBI and Bio-Perl ] - not tested

Under Construction


Using available tools based on Bio::NEXUS (Nexplorer, nextool and nexplot)

Many of the manipulations described above can be carried out using the command-driven program nextool. The nexplot tool can create sophisticated views of your data for use in presentations and publications. The nexplorer server ( can carry out a limited set of manipulations and views, but has the advantage of a graphical user interface. Thus, the combination of Bio::NEXUS and pre-built tools allows a choice:


See the user tutorial of Nexplorer here:


 system$ -h 


 system$ -h 

Going further with Bio::NEXUS

syntax highlighting: