
Bio::Assembly::IO::tigr - Driver to read and write assembly files in the TIGR Assembler v2 default format.

# Building an input stream
use Bio::Assembly::IO;
# Assembly loading methods
my $asmio = Bio::Assembly::IO->new( -file => 'SGC0-424.tasm',
-format => 'tigr' );
my $scaffold = $asmio->next_assembly;
# Do some things on contigs...
# Assembly writing methods
my $outasm = Bio::Assembly::IO->new( -file => ">SGC0-modified.tasm",
-format => 'tigr' );
$outasm->write_assembly( -scaffold => $assembly,
-singlets => 1 );

This package loads and writes assembly information in/from files in the default TIGR Assembler v2 format. The files are lassie-formatted and often have the .tasm extension. This module was written to be used as a driver module for Bio::Assembly::IO input/output.
Assemblies are loaded into Bio::Assembly::Scaffold objects composed of Bio::Assembly::Contig and Bio::Assembly::Singlet objects. Since aligned reads and contig gapped consensus can be obtained in the tasm files, only aligned/gapped sequences are added to the different BioPerl objects.
Additional assembly information is stored as features. Contig objects have SeqFeature information associated with the primary_tag:
_main_contig_feature:$contig_id -> misc contig information
_quality_clipping:$read_id -> quality clipping position
Read objects have sub_seqFeature information associated with the primary_tag:
_main_read_feature:$read_id -> misc read information
Singlets are considered by TIGR Assembler as contigs of one sequence. Contigs are represented here with features having these primary_tag:
_main_contig_feature:$contig_id
_quality_clipping:$read_primary_id
_main_read_feature:$read_primary_id
_aligned_coord:$read_primary_id

In the TIGR tasm lassie format, contigs are separated by a line containing a single pipe character "|", whereas the reads in a contig are separated by a blank line. Singlets can be present in the file and are represented as a contig composed of a single sequence.
Other than the two above-mentioned separators, each line has an attribute name, followed a tab and then an attribute value.
The tasm format is used by more TIGR applications than just TIGR Assembler. Some of the attributes are not used by TIGR Assembler or have constant values. They are indicated by an asterisk *
Contigs have the following attributes:
asmbl_id -> contig ID
sequence -> contig ungapped consensus sequence (ambiguities are lowercase)
lsequence -> gapped consensus sequence (lowercase ambiguities)
quality -> gapped consensus quality score (in hexadecimal)
seq_id -> *
com_name -> *
type -> *
method -> always 'asmg' *
ed_status -> *
redundancy -> fold coverage of the contig consensus
perc_N -> percent of ambiguities in the contig consensus
seq# -> number of sequences in the contig
full_cds -> *
cds_start -> start of coding sequence *
cds_end -> end of coding sequence *
ed_pn -> name of editor (always 'GRA') *
ed_date -> date and time of edition
comment -> some comments *
frameshift -> *
Each read has the following attributes:
seq_name -> read name
asm_lend -> position of first base on contig ungapped consensus sequence
asm_rend -> position of last base on contig ungapped consensus sequence
seq_lend -> start of quality-trimmed sequence (aligned read coordinates)
seq_rend -> end of quality-trimmed sequence (aligned read coordinates)
best -> always '0' *
comment -> some comments *
db -> database name associated with the sequence (e.g. >my_db|seq1234)
offset -> offset of the sequence (gapped consensus coordinates)
lsequence -> aligned read sequence (ambiguities are uppercase)
When asm_rend < asm_lend, the sequence was on the complementary DNA strand but its reverse complement is shown in the aligned sequence of the assembly file, not the original read.
Ambiguities are reflected in the contig consensus sequence as lowercase IUPAC characters: a c g t u m r w s y k x n . In the read sequences, however, ambiguities are uppercase: M R W S Y K X N
Example of a contig containing three sequences:
sequence CGATGCTGTACGGCTGTTGCGACAGATTGCGCTGGGTCGATACCGCGTTGGTGATCGGCTTGTTCAGCGGGCTCTGGTTCGGCGACAGCGCGGCGATCTTGGCGGCTGCGAAGGTTGCCGGCGCAATCATGCGCTGCTGACCGTTGACCTGGTCCTGCCAGTACACCCAGTCGCCCACCATGACCTTCAGCGCGTAGCTGTCACAGCCGGCTGTGGTCAGCGCAGTGGCGACGGTGGTGTAGGAGGCGCCAGCAACACCTTGGGTGATCATGTAGCAGCCTTCTGACAGGCCGTAGGTCAGCATGGTCGGCCACTGGGTACCAGTCAGTCGGGTCAACCGAGATTCGCAsCTGAGCGCCACTGCCGCGCAGAGCGTACATGCCCTTGCGGGTCGCGCCGGTAACACCATCCACGCCGATCAGAACTGCGTCGGTGATGGTGGTGTTACCCGAGGTGCCAGTGGTGAAGGCGACGGTCTGGGTGCTGGCCACAGGCGCCAGAGTGGTCGCGCCAACGGTGGCGATGACCAGTTGCGATGGGCCACGGATACCTGACTGCCCGTTGTTCACGGCGCTGACGATGTTCTGCCACAGCGCCAGGCCAGAGCCGGTGATGTTGTCGAACACTTCGGGCGCAACGCCAGGGAGCGAGACGGTCAGCTTCCAGCTCGAAGCAGCGGAGCCAGTAGCCAGGGCGGCGCTGAGCGAGTTGCCGAGCGTGCCGGTGTAGAACGCGGTCAGCGTGGCGCCGGTGGCGGCGGCAGTGTCCTTCAGCGCACTGGTCGCGGCGGTGTCGGTGCCGTCAGTGACGCGCACGGCGCGGATGTTCGAGGCGCCGCCCTGGATTGATACCGCCAGCGCGGTGCACAGGTCGTACTTGCGCACGGTCyGAGTGCCGAACTTCTGCGATGCGTCACCTGGCGAGCCGATAaGCGTGGCGCTGTTCACCGGCCCCCAGTCAGCAATGCCGACGATGCCGAGAATGTCAGTCGGGACGCCATTGATGTAGCGGGTCTTGGGCGCCACTATTTGTATGTACAAATCTGGCGCAGATAAAGCCGCCGTATTCAAATAACCAGCAGGATAGATAGGCATCACGCCTCCAGAATGAAAAAGGCCACCGATTAGGTGGCCTTTGTTGTGTTCGGCTGGCTGTTAGAGCAGCAGCCCGTTTTCCCGCGCAAACGCGAATGGGTCCTTGTCATGCTTCCTGCAATTGCAGGTAGGACAAAGAATTTGCAGGTTGGATTTGTCGTTCGATCCGCCCTTTGCAAGCGGGAACACGTGGTCAACGTGATACCCATCCCTTATGGATATAGTGCACATGGCGCATTTCCAGCGCTGAGCAGCCAGCAAAAATTTTATGTCGTCGCCGGTGTGTGAGCCGACAGCATTTTTCTTGCGAGCCTTGTATGTCCGCGAGAGTGAACGAACTTGCTCCTTGTTGGCTGTCTTCCAGAGCTTTTGAGTAAGCGCACAGAGATCCTTGTTTCTTGATCTCCACTCTCTGGTTGCGGAAAT
lsequence CGATGCTGTACGGCTGTTGCGACAGATTGCGCTGGGTCGATACCGCGTTGGTGATCGGCTTGTTCAGCGGGCTCTGGTTCGGCGACAGCGCGGCGATCTTGGCGGCTGCGAAGGTTGCCGGCGCAATCATGCGCTGCTGACCGTTGACCTGGTCCTGCCAGTACACCCAGTCGCCCACCATGACCTTCAGCGCGTAGCTGTCACAGCCGGCTGTGGTCAGCGCAGTGGCGACGGTGGTGTAGGAGGCGCCAGCAACACCTTGGGTGATCATGTAGCAGCCTTCTGACAGGCCGTAGGTCAGCATGGTCGGCCACTGGGTACCAGTCAGTCGGGTCAACCGAGATTCG-CAsCTGAGCGCCACTGCCGCGCAGAGCGTACATGCCCTTGCGGGTCGCGCCGGTAACACCATCCACGCCGATCAGAACTGCGTCGGTGATGGTGGTGTTACCCGAGGTGCCAGTGGTGAAGGCGACGGTCTGGGTGCTGGCCACAGGCGCCAGAGTGGTCGCGCCAACGGTGGCGATGACCAGTTGCGATGGGCCACGGATACCTGACTGCCCGTTGTTCACGGCGCTGACGATGTTCTGCCACAGCGCCAGGCCAGAGCCGGTGATGTTGTCGAACACTTCGGGCGCAACGCCAGGGAGCGAGACGGTCAGCTTCCAGCTCGAAGCAGCGGAGCCAGTAGCCAGGGCGGCGCTGAGCGAGTTGCCGAGCGTGCCGGTGTAGAACGCGGTCAGCGTGGCGCCGGTGGCGGCGGCAGTGTCCTTCAGCGCACTGGTCGCGGCGGTGTCGGTGCCGTCAGTGACGCGCACGGCGCGGATGTTCGAGGCGCCGCCCTGGATTGATACCGCCAGCGCGGTGCACAGGTCGTACTTGCGCACGGTCyGAGTGCCGAACTTCTGCGATGCGTCACCTGGCGAGCCGATAaGCGTGGCGCTGTTCACCGGCCCCCAGTCAGCAATGCCGACGATGCCGAGAATGTCAGTCGGGACGCCATTGATGTAGCGGGTCTTGGGCGCCACTATTTGTATGTACAAATCTGGCGCAGATAAAGCCGCCGTATTCAAATAACCAGCAGGATAGATAGGCATCACGCCTCCAGAATGAAAAAGGCCACCGATTAGGTGGCCTTTGTTGTGTTCGGCTGGCTGTTAGAGCAGCAGCCCGTTTTCCCGCGCAAACGCGAATGGGTCCTTGTCATGCTTCCTGCAATTGCAGGTAGGACAAAGAATTTGCAGGTTGGATTTGTCGTTCGATCCGCCCTTTGCAAGCGGGAACACGTGGTCAACGTGATACCCATCCCTTATGGATATAGTGCACATGGCGCATTTCCAGCGCTGAGCAGCCAGCAAAAATTTTATGTCGTCGCCGGTGTGTGAGCCGACAGCATTTTTCTTGCGAGCCTTGTATGTCCGCGAGAGTGAACGAACTTGCTCCTTGTTGGCTGTCTTCCAGAGCTTTTGAGTAAGCGCACAGAGATCCTTGTTTCTTGATCTCCACTCTCTGGTTGCGGAAAT
quality 0x0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0505050505050505050E0505160505050505050505050505050505050505050505050505050505050303030303030303030303030303030303030303030303030303030303030303030303030303030303030303030303030303030303030303030303030303030303090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0404040404040404041604040404040404040404040404040404040404040404040404040404040404040404040404040404040E0404040404040404040B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090909090B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B
asmbl_id 93
seq_id
com_name
type
method asmg
ed_status
redundancy 1.11
perc_N 0.20
seq# 3
full_cds
cds_start
cds_end
ed_pn GRA
ed_date 08/16/07 17:10:12
comment
frameshift
seq_name SDSU_RFPERU_010_C09.x01.phd.1
asm_lend 1
asm_rend 4423
seq_lend 1
seq_rend 442
best 0
comment
db
offset 0
lsequence CGATGCTGTACGGCTGTTGCGACAGATTGCGCTGGGTCGATACCGCGTTGGTGATCGGCTTGTTCAGCGGGCTCTGGTTCGGCGACAGCGCGGCGATCTTGGCGGCTGCGAAGGTTGCCGGCGCAATCATGCGCTGCTGACCGTTGACCTGGTCCTGCCAGTACACCCAGTCGCCCACCATGACCTTCAGCGCGTAGCTGTCACAGCCGGCTGTGGTCAGCGCAGTGGCGACGGTGGTGTAGGAGGCGCCAGCAACACCTTGGGTGATCATGTAGCAGCCTTCTGACAGGCCGTAGGTCAGCATGGTCGGCCACTGGGTACCAGTCAGTCGGGTCAACCGAGATTCG-CAGCTGAGCGCCACTGCCGCGCAGAGCGTACATGCCCTTGCGGGTCGCGCCGGTAACACCATCCACGCCGATCAGAACTGCGTCGGTGATGGTGG
seq_name SDSU_RFPERU_002_H12.x01.phd.1
asm_lend 339
asm_rend 940
seq_lend 1
seq_rend 602
best 0
comment
db
offset 338
lsequence CGAGATTCGCCACCTGAGCGCCACTGCCGCGCAGAGCGTACATGCCCTTGCGGGTCGCGCCGGTAACACCATCCACGCCGATCAGAACTGCGTCGGTGATGGTGGTGTTACCCGAGGTGCCAGTGGTGAAGGCGACGGTCTGGGTGCTGGCCACAGGCGCCAGAGTGGTCGCGCCAACGGTGGCGATGACCAGTTGCGATGGGCCACGGATACCTGACTGCCCGTTGTTCACGGCGCTGACGATGTTCTGCCACAGCGCCAGGCCAGAGCCGGTGATGTTGTCGAACACTTCGGGCGCAACGCCAGGGAGCGAGACGGTCAGCTTCCAGCTCGAAGCAGCGGAGCCAGTAGCCAGGGCGGCGCTGAGCGAGTTGCCGAGCGTGCCGGTGTAGAACGCGGTCAGCGTGGCGCCGGTGGCGGCGGCAGTGTCCTTCAGCGCACTGGTCGCGGCGGTGTCGGTGCCGTCAGTGACGCGCACGGCGCGGATGTTCGAGGCGCCGCCCTGGATTGATACCGCCAGCGCGGTGCACAGGTCGTACTTGCGCACGGTCCGAGTGCCGAACTTCTGCGATGCGTCACCTGGCGAGCCGATA-GCGTGGCGC
seq_name SDSU_RFPERU_009_E07.x01.phd.1
asm_lend 880
asm_rend 1520
seq_lend 641
seq_rend 1
best 0
comment
db
offset 8803
lsequence CGCACGGTCTGAGTGCCGAACTTCTGCGATGCGTCACCTGGCGAGCCGATAAGCGTGGCGCTGTTCACCGGCCCCCAGTCAGCAATGCCGACGATGCCGAGAATGTCAGTCGGGACGCCATTGATGTAGCGGGTCTTGGGCGCCACTATTTGTATGTACAAATCTGGCGCAGATAAAGCCGCCGTATTCAAATAACCAGCAGGATAGATAGGCATCACGCCTCCAGAATGAAAAAGGCCACCGATTAGGTGGCCTTTGTTGTGTTCGGCTGGCTGTTAGAGCAGCAGCCCGTTTTCCCGCGCAAACGCGAATGGGTCCTTGTCATGCTTCCTGCAATTGCAGGTAGGACAAAGAATTTGCAGGTTGGATTTGTCGTTCGATCCGCCCTTTGCAAGCGGGAACACGTGGTCAACGTGATACCCATCCCTTATGGATATAGTGCACATGGCGCATTTCCAGCGCTGAGCAGCCAGCAAAAATTTTATGTCGTCGCCGGTGTGTGAGCCGACAGCATTTTTCTTGCGAGCCTTGTATGTCCGCGAGAGTGAACGAACTTGCTCCTTGTTGGCTGTCTTCCAGAGCTTTTGAGTAAGCGCACAGAGATCCTTGTTTCTTGATCTCCACTCTCTGGTTGCGGAAAT
|
...

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the Bioperl mailing lists Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.
Report bugs to the BioPerl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via email or the web:
bioperl-bugs@bio.perl.org https://redmine.open-bio.org/projects/bioperl/

Email florent dot angly at gmail dot com

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a "_".
Title : next_assembly Usage : my $scaffold = $asmio->next_assembly(); Function: return the next assembly in the tasm-formatted stream Returns : Bio::Assembly::Scaffold object Args : none
Title : next_contig Usage : my $contig = $asmio->next_contig(); Function: return the next contig or singlet TIGR-formatted stream Returns : Bio::Assembly::Contig or Bio::Assembly::Singlet Args : none
Title : _qual_hex2dec
Usage : my dec_quality = $self->_qual_hex2dec($hex_quality);
Function: convert an hexadecimal quality score into a decimal quality score
Returns : string
Args : string
Title : _qual_dec2hex
Usage : my hex_quality = $self->_qual_dec2hex($dec_quality);
Function: convert a decimal quality score into an hexadecimal quality score
Returns : string
Args : string
Title : _store_contig
Usage : my $contigobj = $self->_store_contig(\%contiginfo, $contigobj);
Function: store information of a contig belonging to a scaffold in the
appropriate object
Returns : Bio::Assembly::Contig object
Args : hash, Bio::Assembly::Contig
Title : _store_read
Usage : my $readobj = $self->_store_read(\%readinfo, $contigobj);
Function: store information of a read belonging to a contig in a contig object
Returns : Bio::LocatableSeq
Args : hash, Bio::Assembly::Contig
Title : _store_singlet
Usage : my $singletobj = $self->_store_read(\%readinfo, \%contiginfo);
Function: store information of a singlet belonging to a scaffold in a singlet object
Returns : Bio::Assembly::Singlet
Args : hash, hash
Title : write_assembly
Usage : $asmio->write_assembly($assembly)
Function: Write the assembly object in TIGR Assembler compatible format. The
contig IDs are sorted naturally if the Sort::Naturally module is
present, or lexically otherwise. Internally, write_assembly use
the write_contig, write_footer and write_header methods. Use these
methods if you want more control on the writing process.
Returns : 1 on success, 0 for error
Args : A Bio::Assembly::Scaffold object
1 to write singlets in the assembly file, 0 otherwise
Title : write_contig
Usage : $asmio->write_contig($contig)
Function: Write a contig or singlet object in TIGR compatible format. Quality
scores are automatically generated if the contig does not contain
any
Returns : 1 on success, 0 for error
Args : A Bio::Assembly::Contig or Singlet object
Title : write_header
Usage : $asmio->write_header($assembly)
Function: In the TIGR Asseformat assembly driver, this does nothing. The
method is present for compatibility with other assembly drivers
that need to write a file header.
Returns : 1 on success, 0 for error
Args : A Bio::Assembly::Scaffold object
Title : write_footer
Usage : $asmio->write_footer($assembly)
Function: Write TIGR footer, i.e. do nothing except making sure that the
file does not end with a '|'.
Returns : 1 on success, 0 for error
Args : A Bio::Assembly::Scaffold object
Title : _perc_N
Usage : my $perc_N = $asmio->_perc_N($sequence_string)
Function: Calculate the percent of ambiguities in a sequence.
M R W S Y K X N are regarded as ambiguities in an aligned read
sequence by TIGR Assembler. In the case of a gapped contig
consensus sequence, all lowercase symbols are ambiguities, i.e.:
a c g t u m r w s y k x n.
Returns : decimal number
Args : string
Title : _redundancy
Usage : my $ref = $asmio->_redundancy($contigobj)
Function: Calculate the fold coverage (redundancy) of a contig consensus
(average number of read base pairs covering the consensus)
Returns : decimal number
Args : Bio::Assembly::Contig
Title : _ungap
Usage : my $ungapped = $asmio->_ungap($gapped)
Function: Remove the gaps from a sequence. Gaps are - in TIGR Assembler
Returns : string
Args : string
Title : _date_time
Usage : my $timepoint = $asmio->date_time
Function: Get date and time (MM//DD/YY HH:MM:SS)
Returns : string
Args : none
Title : _split_seq_name_and_db
Usage : my ($seqname, $db) = $asmio->_split_seq_name_and_db($id)
Function: Extract seq_name and db from sequence id
Returns : seq_name, db
Args : id
Title : _merge_seq_name_and_db
Usage : my $id = $asmio->_merge_seq_name_and_db($seq_name, $db)
Function: Construct id from seq_name and db
Returns : id
Args : seq_name, db
Title : _coord
Usage : my $id = $asmio->__coord($readobj, $contigobj)
Function: Get different coordinates for the read
Returns : number, number, number, number, number
Args : Bio::Assembly::Seq, Bio::Assembly::Contig