#
# BioPerl module for Bio::Tools::Spidey::Results
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Cared for by Ryan Golhar <golharam@umdnj.edu>
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::Tools::Spidey::Results - Results of a Spidey run
=head1 SYNOPSIS
use Bio::Tools::Spidey::Results;
my $spidey = Bio::Tools::Spidey::Results->new(-file => 'result.spidey' );
# or
my $spidey = Bio::Tools::Spidey::Results->new( -fh => \*INPUT );
# get the exons before doing anything else
my $exonset = $spidey->next_exonset();
# parse the results
my @exons = $exonset->sub_SeqFeature();
print "Total no of Exons: ", scalar(@exons), "\n";
print "Genomic sequence length: ", $spidey->genomic_dna_length(), "\n";
# $exonset is-a Bio::SeqFeature::Generic with Bio::Tools::Spidey::Exons
# as sub features
print "Delimited on sequence ", $exonset->seq_id(), " from ",
$exonset->start(), " to ", $exonset->end(), "\n";
foreach my $exon ( $exonset->sub_SeqFeature() ) {
# $exon is-a Bio::SeqFeature::FeaturePair
print "Exon from ", $exon->start, " to ", $exon->end,
" on strand ", $exon->strand(), "\n";
# you can get out what it matched using the est_hit attribute
my $homol = $exon->est_hit();
print "Matched to sequence ", $homol->seq_id,
" at ", $homol->start," to ", $homol->end, "\n";
}
# essential if you gave a filename at initialization (otherwise
# the file stays open)
$spidey->close();
=head1 DESCRIPTION
The spidey module provides a parser and results object for spidey
output. The spidey results are specialised types of SeqFeatures,
meaning you can add them to AnnSeq objects fine, and manipulate them
in the "normal" seqfeature manner.
The spidey Exon objects are Bio::SeqFeature::FeaturePair inherited
objects. The $esthit = $exon-E<gt>est_hit() is the alignment as a
feature on the matching object (normally, a cDNA), in which the
start/end points are where the hit lies.
To make this module work sensibly you need to run
spidey -i genomic.fasta -m cDNA.fasta
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the
web:
https://github.com/bioperl/bioperl-live/issues
=head1 AUTHOR - Ryan Golhar
Email golharam@umdnj.edu
=head1 APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::Tools::Spidey::Results;
use strict;
use File::Basename;
use Bio::Root::Root;
use Bio::Tools::Spidey::Exon;
use base qw(Bio::Tools::AnalysisResult);
sub _initialize_state {
my($self,@args) = @_;
# call the inherited method first
my $make = $self->SUPER::_initialize_state(@args);
# my ($est_is_first) = $self->_rearrange([qw(ESTFIRST)], @args);
# delete($self->{'_est_is_first'});
# $self->{'_est_is_first'} = $est_is_first if(defined($est_is_first));
$self->analysis_method("Spidey");
}
=head2 analysis_method
Usage : $spidey->analysis_method();
Purpose : Inherited method. Overridden to ensure that the name matches
/Spidey/i.
Returns : String
Argument : n/a
=cut
#-------------
sub analysis_method {
#-------------
my ($self, $method) = @_;
if($method && ($method !~ /Spidey/i)) {
$self->throw("method $method not supported in " . ref($self));
}
return $self->SUPER::analysis_method($method);
}
=head2 parse_next_alignment
Title : parse_next_alignment
Usage : @exons = $spidey_result->parse_next_alignment;
foreach $exon (@exons) {
# do something
}
Function: Parses the next alignment of the Spidey result file and returns the
found exons as an array of Bio::Tools::Spidey::Exon objects. Call
this method repeatedly until an empty array is returned to get the
results for all alignments.
Example :
Returns : An array of Bio::Tools::Spidey::Exon objects
Args :
=cut
sub parse_next_alignment {
my ($self) = @_;
# for strand 1 = plus, -1 = minus
my ($started,$version,$strand, $exoncount) = (0,0,0,-1);
my (%seq1props,%seq2props,@exons);
# we refer to the properties of each seq by reference
while(defined($_ = $self->_readline())) {
chomp;
#
# bascially, parse a Spidey result...
#
# matches: --SPIDEY version 1.40--
if( /^--SPIDEY\s+version\s+(\d+\.\d+)--/) {
if($started) {
$self->_pushback($_);
return \@exons;
}
$version = $1;
if ($version != 1.40) {
$self->throw("Spidey parser only designed to work with Spidey v1.40\n");
}
$started = 1;
} elsif (/^Genomic:\s+(\S+)\s.*,\s+(\d+)\sbp$/ ) {
# matches: Genomic: lcl|some_name other information, 1234 bp
# $seq1props{'filename'} = $1;
$seq1props{'seqname'} = $1;
$seq1props{'length'} = $2;
$self->genomic_dna_length($seq1props{'length'});
} elsif( /^mRNA:\s+(\S+)\s.*,(?:\s+mRNA\s+sequence,)?\s(\d+)\sbp$/ ) {
# matches: mRNA:
# $seq2props{'filename'} = $1;
$seq2props{'seqname'} = $1;
$seq2props{'length'} = $2;
} elsif( /^Strand:/ ) {
if (/plus/) {
$strand = 1;
} else {
$strand = -1;
}
} elsif( /^Number of exons: (\d+)/ ) {
$exoncount = $1;
my ($genomic_start, $genomic_stop, $cdna_start, $cdna_stop,
$id, $mismatches, $gaps, $splice_donor,
$splice_acceptor, $uncertain);
# the next $exoncount lines contains information
# about the matches of each exon. we should parse
# this information here
for (my $ec = 1; $ec <= $exoncount; $ec++) {
if (defined($_ = $self->_readline())) {
chomp;
if (/^Exon\s$ec[\(\)-]*:\s(\d+)-(\d+)\s\(gen\)\s+(\d+)-(\d+)\s\(mRNA\)\s+id\s([\d\.inf-]+)%\s+mismatches\s(\d+)\s+gaps\s(\d+)\s+splice\ssite\s\(d\s+a\):\s(\d+)\s+(\d+)\s*(\w*)/) {
$genomic_start = $1;
$genomic_stop = $2;
$cdna_start = $3;
$cdna_stop = $4;
$id = $5;
$mismatches = $6;
$gaps = $7;
$splice_donor = $8;
$splice_acceptor = $9;
$uncertain = $10;
} else {
$self->throw( "Failed to match anything:\n$_\n");
}
my $exon = Bio::Tools::Spidey::Exon->new
(-start => $genomic_start,
-end => $genomic_stop,
-strand => $strand);
$exon->seq_id($seq1props{'seqname'});
# feature1 is supposed to be initialized to a Similarity object, but we provide a safety net
if ($exon->feature1->can('seqlength')) {
$exon->feature1->seqlength($seq1props{'length'});
} else {
$exon->feature1->add_tag_value('seqlength', $seq1props{'length'});
}
# create and initialize the feature wrapping the 'hit' (the cDNA)
my $fea2 = Bio::SeqFeature::Similarity->new
(-start => $cdna_start,
-end => $cdna_stop,
-strand => $strand,
-seq_id => $seq2props{'seqname'},
-primary => "aligning_cDNA");
$fea2->seqlength($seq2props{'length'});
# store
$exon->est_hit($fea2);
# general properties
$exon->source_tag($self->analysis_method());
$exon->percentage_id($5);
$exon->mismatches($6);
$exon->gaps($7);
$exon->donor($8);
$exon->acceptor($9);
# push onto array
push(@exons, $exon);
} else {
$self->throw("Unexpected end of file reached\n");
}
}
} elsif( /^Number of splice sites:\s+(\d+)/ ) {
$self->splicesites($1);
} elsif( /^mRNA coverage:\s+(\d+)%/ ) {
$self->est_coverage($1);
} elsif(/^overall percent identity:\s+([\d\.]+)%/ ) {
$self->overall_percentage_id($1);
} elsif(/^Missing mRNA ends:\s+(\w+)/ ) {
$self->missing_mrna_ends($1);
} elsif( /^Exon (\d+): (\d+)-(\d+) \(gen\)\s+(\d+)-(\d+) \(mRNA\)/ ) {
my ($exon_num, $gen_start, $gen_stop, $cdna_start, $cdna_stop);
$exon_num = $1;
$gen_start = $2;
$gen_stop = $3;
$cdna_start = $4;
$cdna_stop = $5;
} elsif( /No alignment found/ ) {
return [];
} else {
#$self->debug("unmatched $_\n");
}
}
# Typical format:
# Exon 1: 36375798-36375691 (gen) 1-108 (mRNA)
#
#
# CCTCTTTTTCTTTGCAGGGTATATACCCAGTTACTTAGACAAGGATGAGCTATGTGTAGT
# | ||||||||||||||||||||||||||||||||||||||||||||||
# ATGTCAGGGTATATACCCAGTTACTTAGACAAGGATGAGCTATGTGTAGT
# M S G Y I P S Y L D K D E L C V V
#
#
# ATGTGGGGACAAAGCCACCGGATATCATTATCGCTGCATCACTTGTGAAGGTTGCAAGGT
# ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
# ATGTGGGGACAAAGCCACCGGATATCATTATCGCTGCATCACTTGTGAAGGTTGCAAG
# C G D K A T G Y H Y R C I T C E G C K
#
#
# AAATGGCA
#
@exons ? return \@exons : return ;
}
=head2 next_exonset
Title : next_exonset
Usage : $exonset = $spidey_result->parse_next_exonset;
print "Exons start at ", $exonset->start(),
"and end at ", $exonset->end(), "\n";
for $exon ($exonset->sub_SeqFeature()) {
# do something
}
Function: Parses the next alignment of the Spidey result file and returns the
set of exons as a container of features. The container is itself
a Bio::SeqFeature::Generic object, with the Bio::Tools::Spidey::Exon
objects as sub features. Start, end, and strand of the container
will represent the total region covered by the exons of this set.
See the documentation of parse_next_alignment() for further
reference about parsing and how the information is stored.
Example :
Returns : An Bio::SeqFeature::Generic object holding Bio::Tools::Spidey::Exon
objects as sub features.
Args :
=cut
sub next_exonset {
my $self = shift;
my $exonset;
# get the next array of exons
my $exons = $self->parse_next_alignment();
if( ! defined $exons ) {
$self->warn("No exons returned");
return;
}
if( @$exons == 0 ) {
return Bio::SeqFeature::Generic->new();
}
# create the container of exons as a feature object itself, with the
# data of the first exon for initialization
$exonset = Bio::SeqFeature::Generic->new('-start' => $exons->[0]->start(),
'-end' => $exons->[-1]->end(),
'-strand' => $exons->[0]->strand(),
'-primary' => "ExonSet");
$exonset->source_tag($exons->[0]->source_tag());
$exonset->seq_id($exons->[0]->seq_id());
# now add all exons as sub features, with enabling EXPANsion of the region
# covered in total
foreach my $exon (@$exons) {
$exonset->add_sub_SeqFeature($exon, 'EXPAND');
}
return $exonset;
}
=head2 next_feature
Title : next_feature
Usage : while($exonset = $spidey->next_feature()) {
# do something
}
Function: Does the same as L<next_exonset()>. See there for documentation of
the functionality. Call this method repeatedly until FALSE is
returned.
The returned object is actually a SeqFeatureI implementing object.
This method is required for classes implementing the
SeqAnalysisParserI interface, and is merely an alias for
next_exonset() at present.
Example :
Returns : A Bio::SeqFeature::Generic object.
Args :
=cut
sub next_feature {
my ($self,@args) = @_;
# even though next_exonset doesn't expect any args (and this method
# does neither), we pass on args in order to be prepared if this changes
# ever
return $self->next_exonset(@args);
}
=head2 genomic_dna_length
Title : genomic_dna_length
Usage : $spidey->genomic_dna_length();
Function: Returns the length of the genomic DNA used in this Spidey result
Example :
Returns : An integer value.
Args :
=cut
sub genomic_dna_length {
my ($self, @args) = @_;
my $val;
if(@args) {
$val = shift(@args);
$self->{'genomic_dna_length'} = $val;
} else {
$val = $self->{'genomic_dna_length'};
}
return $val;
}
=head2 splicesites
Title : splicesites
Usage : $spidey->splicesites();
Function: Returns the number of splice sites found in this Spidey result
Example :
Returns : An integer value.
Args :
=cut
sub splicesites {
my ($self, @args) = @_;
my $val;
if(@args) {
$val = shift(@args);
$self->{'splicesites'} = $val;
} else {
$val = $self->{'splicesites'};
}
return $val;
}
=head2 est_coverage
Title : est_coverage
Usage : $spidey->est_coverage();
Function: Returns the percent of est coverage in this Spidey result
Example :
Returns : An integer value.
Args :
=cut
sub est_coverage {
my ($self, @args) = @_;
my $val;
if(@args) {
$val = shift(@args);
$self->{'est_coverage'} = $val;
} else {
$val = $self->{'est_coverage'};
}
return $val;
}
=head2 overall_percentage_id
Title : overall_percentage_id
Usage : $spidey->overall_percentage_id();
Function: Returns the overall percent id in this Spidey result
Example :
Returns : An float value.
Args :
=cut
sub overall_percentage_id {
my ($self, @args) = @_;
my $val;
if(@args) {
$val = shift(@args);
$self->{'overall_percentage_id'} = $val;
} else {
$val = $self->{'overall_percentage_id'};
}
return $val;
}
=head2 missing_mrna_ends
Title : missing_mrna_ends
Usage : $spidey->missing_mrna_ends();
Function: Returns left/right/neither from Spidey
Example :
Returns : A string value.
Args :
=cut
sub missing_mrna_ends {
my ($self, @args) = @_;
my $val;
if(@args) {
$val = shift(@args);
$self->{'missing_mrna_ends'} = $val;
} else {
$val = $self->{'missing_mrna_ends'};
}
return $val;
}
1;