The Perl Toolchain Summit needs more sponsors. If your company depends on Perl, please support this very important event.
Tandem Repeats Finder Program writen by:



Gary Benson

Department of Biomathematical Sciences

Mount Sinai School of Medicine

Version 4.00





Sequence: DDB0169550 |Masked Chromosomal Sequence| on chromosome: M







Parameters: 2 7 7 80 10 50 12





13936 13960 12 2.1 12 100 0 50 16 8 52 24 1.70 GGCGTAATGGGT GGCGTAATGGGTGGCGTAATGGGTG

16937 16965 9 3.2 9 100 0 58 44 0 10 44 1.38 TATATAGTA TATATAGTATATATAGTATATATAGTATA







Sequence: DDB0215018 |Masked Chromosomal Sequence| on chromosome: 2F







Parameters: 2 7 7 80 10 50 12





1649 1679 1 31.0 1 100 0 62 0 0 0 100 0.00 T TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT