# fasta34 -Q -H -E 10 -m 9 -b 1 -d 1 -r 15/-10 -g -12 -n -U ../testfiles/NAC_miRNA.fasta ../databases/cotton/CGI8.fasta
FASTA searches a protein or DNA sequence data bank
version 3.4t25 Sept 2, 2005
Please cite:
W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
Query library ../testfiles/NAC_miRNA.fasta vs ../databases/cotton/CGI8.fasta library
searching ../databases/cotton/CGI8.fasta library
1>>>total:39860_L:12096_-3:12346_0:617_+3:14801 - 22 nt (forward-only)
vs ../databases/cotton/CGI8.fasta library
43526801 residues in 55673 sequences
Expectation_n fit: rho(ln(x))= 23.6457+/-0.000561; mu= -11.6380+/- 0.037
mean_var=607.0983+/-151.124, 0's: 0 Z-trim: 2 B-trim: 0 in 0/43
Lambda= 0.052053
FASTA (3.47 Mar 2004) function [optimized, 15/-10 matrix (15:-10)] ktup: 2
join: 213, opt: 198, open/ext: -12/-12, width: 16
Scan time: 2.700
The best scores are: opt bits E(55673) %_id %_sim bs alen an0 ax0 pn0 px0 an1 ax1 pn1 px1 gapq gapl fs
BE054209 similar to PRF|NP_974632.1|42573071|N ( 510) [f] 286 25.6 19 0.762 0.952 286 21 1 21 1 22 471 491 1 510 0 0 0
>>>total:39860_L:12096_-3:12346_0:617_+3:14801, 22 nt vs ../databases/cotton/CGI8.fasta library
>>BE054209 similar to PRF|NP_974632.1|42573071|NP_974632 pfkB-type carbohydrate kinase family pr (510 nt)
initn: 286 init1: 286 opt: 286 Z-score: 111.0 bits: 25.6 E(): 19
banded Smith-Waterman score: 286; 76.190% identity (95.238% similar) in 21 nt overlap (1-21:471-491)
10 20
total: UUGGACAGAGUAAUCACGGUCG
:::::..:::::: .:.::::
BE0542 GAACUNUCUCAGUCAAGUUUAUUAUCUGCAUUGGAUGGAGUAAAUAUGGUCUACUUUGAUGGAAGACAUC
450 460 470 480 490 500 510
22 residues in 1 query sequences
43526801 residues in 55673 library sequences
Scomplib [34t25]
start: Sat Mar 22 16:31:47 2008 done: Sat Mar 22 16:31:49 2008
Total Scan time: 2.700 Total Display time: 0.000
Function used was FASTA [version 3.4t25 Sept 2, 2005]