The London Perl and Raku Workshop takes place on 26th Oct 2024. If your company depends on Perl, please consider sponsoring and/or attending.
ID           M20132:(362)[c.+4G|A|T;c.+31C|A]; [E2|K|X;Q11|K]
Feature      DNA; 1.1
Feature        /label: point, transition
Feature        /proof: computed
Feature        /location: 4
Feature        /upflank: gaagattcagccaagctcaaggatg
Feature        /change: g|a
Feature        /dnflank: aagtgcagttagggctgggaagggt
Feature        /re_site: -BccI
Feature      DNA; 1.2
Feature        /label: point, transversion
Feature        /proof: computed
Feature        /location: 4
Feature        /upflank: gaagattcagccaagctcaaggatg
Feature        /change: g|t
Feature        /dnflank: aagtgcagttagggctgggaagggt
Feature        /re_site: -BccI
Feature      RNA; 1.1
Feature        /label: missense
Feature        /proof: experimental
Feature        /location: 4 (M20132::366)
Feature        /upflank: gaagattcagccaagctcaaggatg
Feature        /change: g|a
Feature        /dnflank: aagtgcagttagggctgggaagggt
Feature        /re_site: -BccI
Feature        /codon_table: 1
Feature        /codon: gaa|aaa; 1
Feature        /region: coding
Feature      RNA; 1.2
Feature        /label: nonsense
Feature        /proof: experimental
Feature        /location: 4 (M20132::366)
Feature        /upflank: gaagattcagccaagctcaaggatg
Feature        /change: g|t
Feature        /dnflank: aagtgcagttagggctgggaagggt
Feature        /re_site: -BccI
Feature        /codon_table: 1
Feature        /codon: gaa|taa; 1
Feature        /region: coding
Feature      AA; 1.1
Feature        /label: substitution, conservative
Feature        /proof: computed
Feature        /location: 2
Feature        /change: E|K
Feature      AA; 1.2
Feature        /label: truncation
Feature        /proof: computed
Feature        /location: 2
Feature        /change: E|*
Feature      DNA; 2
Feature        /label: point, transversion
Feature        /proof: computed
Feature        /location: 31
Feature        /upflank: gaagattcagccaagctcaaggatg
Feature        /change: c|a
Feature        /dnflank: aagtgcagttagggctgggaagggt
Feature        /re_site: -CviRI, -SfaNI
Feature      RNA; 2
Feature        /label: missense
Feature        /proof: experimental
Feature        /location: 31 (M20132::393)
Feature        /upflank: gaagattcagccaagctcaaggatg
Feature        /change: c|a
Feature        /dnflank: aagtgcagttagggctgggaagggt
Feature        /re_site: -CviRI, -SfaNI
Feature        /codon_table: 1
Feature        /codon: caa|aaa; 1
Feature        /region: coding
Feature      AA; 2
Feature        /label: substitution, conservative
Feature        /proof: computed
Feature        /location: 11
Feature        /change: Q|K
//