#
# BioPerl module for Bio::Tools::Run::StandAloneBlast
#
# Copyright Peter Schattner
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::Tools::Run::StandAloneWUBlast - Object for the local execution
of WU-Blast.
=head1 SYNOPSIS
# Do not use directly; use Bio::Tools::Run::StandAloneBlast
=head1 DESCRIPTION
See Bio::Tools::Run::StandAloneBlast
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via
the web:
https://redmine.open-bio.org/projects/bioperl/
=head1 AUTHOR - Peter Schattner
Email schattner at alum.mit.edu
=head1 MAINTAINER - Torsten Seemann
Email torsten at infotech.monash.edu.au
=head1 CONTRIBUTORS
Sendu Bala bix@sendu.me.uk (reimplementation)
=head1 APPENDIX
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
=cut
package Bio::Tools::Run::StandAloneWUBlast;
use strict;
use base qw(Bio::Tools::Run::StandAloneBlast);
our $AUTOLOAD;
our $DEFAULTREADMETHOD = 'BLAST';
# If local BLAST databases are not stored in the standard
# /data directory, the variable BLASTDATADIR will need to be
# set explicitly
our $DATADIR = $Bio::Tools::Run::StandAloneBlast::DATADIR;
our %GENERAL_PARAMS = (i => 'input',
o => 'outfile',
p => 'program',
d => 'database');
our @WUBLAST_PARAMS = qw(e s e2 s2 w t x m y z l k h v b q r
matrix filter wordmask filter maskextra hitdist wink ctxfactor gape
gaps gape2 gaps2 gapw gapx olf golf olmax golmax gapdecayrate
topcombon topcomboe sumstatsmethod hspsepqmax hspsepsmax gapsepqmax
gapsepsmax altscore hspmax gspmax qoffset nwstart nwlen qrecmin qrecmax
dbrecmin dbrecmax vdbdescmax dbchunks sort_by_pvalue cpus putenv
getenv progress);
our @WUBLAST_SWITCH = qw(kap sump poissonp lcfilter lcmask echofilter
stats nogap gapall pingpong nosegs postsw span2 span1 span prune
consistency links ucdb gi noseqs qtype qres sort_by_pvalue
sort_by_count sort_by_highscore sort_by_totalscore
sort_by_subjectlength mmio nonnegok novalidctxok shortqueryok notes
warnings errors endputenv getenv endgetenv abortonerror abortonfatal);
our @OTHER_PARAMS = qw(_READMETHOD);
=head2 new
Title : new
Usage : my $obj = Bio::Tools::Run::StandAloneBlast->new();
Function: Builds a newBio::Tools::Run::StandAloneBlast object
Returns : Bio::Tools::Run::StandAloneBlast
Args : -quiet => boolean # make program execution quiet
-_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
# the parsing method, case insensitive
Essentially all BLAST parameters can be set via StandAloneBlast.pm.
Some of the most commonly used parameters are listed below. All
parameters have defaults and are optional except for -p.
-p Program Name [String]
Input should be one of "wublastp", "wublastn", "wublastx",
"wutblastn", or "wutblastx".
-d Database [String] default = nr
The database specified must first be formatted with xdformat.
-E Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
=cut
sub new {
my ($caller, @args) = @_;
my $self = $caller->SUPER::new(@args);
$self->_set_from_args(\@args, -methods => {(map { $_ => $GENERAL_PARAMS{$_} } keys %GENERAL_PARAMS),
(map { $_ => $_ } (@OTHER_PARAMS,
@WUBLAST_PARAMS,
@WUBLAST_SWITCH))},
-create => 1,
-force => 1);
my ($tfh, $tempfile) = $self->io->tempfile();
my $outfile = $self->o || $self->outfile || $tempfile;
$self->o($outfile);
close($tfh);
$self->_READMETHOD($DEFAULTREADMETHOD) unless $self->_READMETHOD;
return $self;
}
# We let get/setter method names be case-insensitve
sub AUTOLOAD {
my $self = shift;
my $attr = $AUTOLOAD;
$attr =~ s/.*:://;
my $orig = $attr;
$attr = lc($attr);
$self->can($attr) || $self->throw("Unallowed parameter: $orig !");
return $self->$attr(@_);
}
=head2 wublast
Title : wublast
Usage : $blast_report = $factory->wublast('t/testquery.fa');
or
$input = Bio::Seq->new(-id=>"test query",
-seq=>"ACTACCCTTTAAATCAGTGGGGG");
$blast_report = $factory->wublast($input);
or
$seq_array_ref = \@seq_array; # where @seq_array is an array of Bio::Seq objects
$blast_report = $factory->wublast(\@seq_array);
Returns : Reference to a Blast object
Args : Name of a file or Bio::Seq object or an array of
Bio::Seq object containing the query sequence(s).
Throws an exception if argument is not either a string
(eg a filename) or a reference to a Bio::Seq object
(or to an array of Seq objects). If argument is string,
throws exception if file corresponding to string name can
not be found.
=cut
sub wublast {
my ($self, $input1) = @_;
$self->io->_io_cleanup();
my $executable = 'wublast';
# Create input file pointer
my $infilename1 = $self->_setinput($executable, $input1) || $self->throw("$input1 not Bio::Seq object or array of Bio::Seq objects or file name!");
$self->i($infilename1);
my $blast_report = $self->_generic_local_wublast($executable);
}
=head2 _generic_local_wublast
Title : _generic_local_wublast
Usage : internal function not called directly
Returns : Blast object
Args : Reference to calling object and name of BLAST executable
=cut
sub _generic_local_wublast {
my $self = shift;
my $executable = shift;
# Create parameter string to pass to Blast program
my $param_string = $self->_setparams($executable);
$param_string = " ".$self->database." ".$self->input." ".$param_string;
# run Blast
my $blast_report = $self->_runwublast($executable, $param_string);
}
=head2 _runwublast
Title : _runwublast
Usage : Internal function, not to be called directly
Function: makes actual system call to WU-Blast program
Example :
Returns : Report Blast object
Args : Reference to calling object, name of BLAST executable,
and parameter string for executable
=cut
sub _runwublast {
my ($self, $executable, $param_string) = @_;
my ($blast_obj, $exe);
if (! ($exe = $self->executable($self->p))){
$self->warn("cannot find path to $executable");
return;
}
my $commandstring = $exe.$param_string;
$self->debug("$commandstring\n");
system($commandstring) && $self->throw("$executable call crashed: $? | $! | $commandstring\n");
# get outputfilename
my $outfile = $self->o();
$blast_obj = Bio::SearchIO->new(-file => $outfile, -format => 'blast');
return $blast_obj;
}
=head2 _setparams
Title : _setparams
Usage : Internal function, not to be called directly
Function: Create parameter inputs for Blast program
Example :
Returns : parameter string to be passed to Blast
Args : Reference to calling object and name of BLAST executable
=cut
sub _setparams {
my ($self, $executable) = @_;
my ($attr, $value, @execparams);
@execparams = @WUBLAST_PARAMS;
# of the general params, wublast only takes outfile at
# this stage (we add in program, input and database manually elsewhere)
push(@execparams, 'o');
# workaround for problems with shell metacharacters [bug 2707]
# simply quoting does not always work!
# Fixed so Windows files are not quotemeta'd
my $tmp = $self->o;
$self->o(quotemeta($tmp)) if ($tmp && $^O !~ /^MSWin/);
my $param_string = $self->SUPER::_setparams(-params => [@execparams],
-switches => \@WUBLAST_SWITCH,
-dash => 1);
$self->o($tmp) if ($tmp && $^O !~ /^MSWin/);
if ($self->quiet()) {
$param_string .= ' 2> '.File::Spec->devnull;
}
return $param_string;
}
1;