#!/usr/bin/perl
# PROGRAM : rev_and_trans.pl
# PURPOSE : Simple driver for Bio::Seq revcom and translate
# AUTHOR : Ewan Birney birney@sanger.ac.uk
# CREATED : Tue Oct 27 1998
#
# INSTALLATION
# If you have installed bioperl using the standard
# makefile system everything should be fine and
# dandy.
#
# if not edit the use lib "...." line to point the directory
# containing your Bioperl modules.
#
use Bio::Seq;
use Bio::SeqIO;
# new sequence from raw memory...
# it is *very* important to get the type right so it
# is translated correctly.
$seq = Bio::Seq->new ( -id => "myseq",
-seq => "CGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATGTCTAAGTCAGAGTCTCCT",
-type => 'Dna');
$seqout = Bio::SeqIO->new('-format' => 'fasta', -fh => \*STDOUT);
# make a reverse complement sequence
$rev = $seq->revcom();
# the actual sequence is here
$actual_bases = $rev->seq();
print "Reversed sequence as a string is [$actual_bases]\n";
# we could also write it as fasta formatted output
$seqout->write_seq($rev);
# make a translation
$trans = $seq->translate();
print "Translated sequence!\n";
$seqout->write_seq($trans);