# -*-Perl-*- Test Harness script for Bioperl
# $Id$
use strict;
BEGIN {
use lib '.';
# use List::MoreUtils qw(uniq);
use Bio::Root::Test;
test_begin(-tests => 133);
use_ok('Bio::PrimarySeq');
use_ok('Bio::SeqUtils');
use_ok('Bio::LiveSeq::Mutation');
use_ok('Bio::SeqFeature::Generic');
use_ok('Bio::Annotation::SimpleValue');
use_ok('Bio::Annotation::Collection');
use_ok('Bio::Annotation::Comment');
}
my ($seq, $util, $ascii, $ascii_aa, $ascii3);
# Entire alphabet now IUPAC-endorsed and used in GenBank (Oct 2006)
$ascii = 'ABCDEFGHIJKLMNOPQRSTUVWXYZ';
$ascii_aa = 'ABCDEFGHIJKLMNOPQRSTUVWXYZ';
$ascii3 =
'AlaAsxCysAspGluPheGlyHisIleXleLysLeuMetAsnPylProGlnArgSerThrSecValTrpXaaTyrGlx';
$seq = Bio::PrimarySeq->new('-seq'=> $ascii,
'-alphabet'=>'protein',
'-id'=>'test');
# one letter amino acid code to three letter code
ok $util = Bio::SeqUtils->new();
is $util->seq3($seq), $ascii3;
#using anonymous hash
is (Bio::SeqUtils->seq3($seq), $ascii3);
is (Bio::SeqUtils->seq3($seq, undef, ','),
'Ala,Asx,Cys,Asp,Glu,Phe,Gly,His,Ile,Xle,Lys,'.
'Leu,Met,Asn,Pyl,Pro,Gln,Arg,Ser,Thr,Sec,Val,Trp,Xaa,Tyr,Glx');
$seq->seq('asd-KJJK-');
is (Bio::SeqUtils->seq3($seq, '-', ':'),
'Ala:Ser:Asp:Ter:Lys:Xle:Xle:Lys:Ter');
# three letter amino acid code to one letter code
ok (Bio::SeqUtils->seq3in($seq, 'AlaPYHCysAspGlu'));
is $seq->seq, 'AXCDE';
is (Bio::SeqUtils->seq3in($seq, $ascii3)->seq, $ascii_aa);
#
# Tests for multiframe translations
#
$seq = Bio::PrimarySeq->new('-seq'=> 'agctgctgatcggattgtgatggctggatggcttgggatgctgg',
'-alphabet'=>'dna',
'-id'=>'test2');
my @a = $util->translate_3frames($seq);
is scalar @a, 3;
#foreach $a (@a) {
# print 'ID: ', $a->id, ' ', $a->seq, "\n";
#}
@a = $util->translate_6frames($seq);
is scalar @a, 6;
#foreach $a (@a) {
# print 'ID: ', $a->id, ' ', $a->seq, "\n";
#}
#
# test for valid AA return
#
my @valid_aa = sort Bio::SeqUtils->valid_aa;
is(@valid_aa, 27);
is($valid_aa[1], 'A');
@valid_aa = sort Bio::SeqUtils->valid_aa(1);
is(@valid_aa, 27);
is ($valid_aa[1], 'Arg');
my %valid_aa = Bio::SeqUtils->valid_aa(2);
is keys %valid_aa, 54;
is($valid_aa{'C'}, 'Cys');
is( $valid_aa{'Cys'}, 'C');
#
# Mutate
#
my $string1 = 'aggt';
$seq = Bio::PrimarySeq->new('-seq'=> 'aggt',
'-alphabet'=>'dna',
'-id'=>'test3');
# point
Bio::SeqUtils->mutate($seq,
Bio::LiveSeq::Mutation->new(-seq => 'c',
-pos => 3
)
);
is $seq->seq, 'agct';
# insertion and deletion
my @mutations = (
Bio::LiveSeq::Mutation->new(-seq => 'tt',
-pos => 2,
-len => 0
),
Bio::LiveSeq::Mutation->new(-pos => 2,
-len => 2
)
);
Bio::SeqUtils->mutate($seq, @mutations);
is $seq->seq, 'agct';
# insertion to the end of the sequence
Bio::SeqUtils->mutate($seq,
Bio::LiveSeq::Mutation->new(-seq => 'aa',
-pos => 5,
-len => 0
)
);
is $seq->seq, 'agctaa';
#
# testing Bio::SeqUtils->cat
#
# PrimarySeqs
my $primseq1 = Bio::PrimarySeq->new(-id => 1, -seq => 'acgt', -description => 'master');
my $primseq2 = Bio::PrimarySeq->new(-id => 2, -seq => 'tgca');
Bio::SeqUtils->cat($primseq1, $primseq2);
is $primseq1->seq, 'acgttgca';
is $primseq1->description, 'master';
#should work for Bio::LocatableSeq
#should work for Bio::Seq::MetaI Seqs?
# Bio::SeqI
my $seq1 = Bio::Seq->new(-id => 1, -seq => 'aaaa', -description => 'first');
my $seq2 = Bio::Seq->new(-id => 2, -seq => 'tttt', -description => 'second');
my $seq3 = Bio::Seq->new(-id => 3, -seq => 'cccc', -description => 'third');
# annotations
my $ac2 = Bio::Annotation::Collection->new();
my $simple1 = Bio::Annotation::SimpleValue->new(
-tagname => 'colour',
-value => 'blue'
), ;
my $simple2 = Bio::Annotation::SimpleValue->new(
-tagname => 'colour',
-value => 'black'
), ;
$ac2->add_Annotation('simple',$simple1);
$ac2->add_Annotation('simple',$simple2);
$seq2->annotation($ac2);
my $ac3 = Bio::Annotation::Collection->new();
my $simple3 = Bio::Annotation::SimpleValue->new(
-tagname => 'colour',
-value => 'red'
);
$ac3->add_Annotation('simple',$simple3);
$seq3->annotation($ac3);
ok (Bio::SeqUtils->cat($seq1, $seq2, $seq3));
is $seq1->seq, 'aaaattttcccc';
is scalar $seq1->annotation->get_Annotations, 3;
# seq features
my $ft2 = Bio::SeqFeature::Generic->new( -start => 1,
-end => 4,
-strand => 1,
-primary => 'source',
-tag => {note => 'note2'},
);
my $ft3 = Bio::SeqFeature::Generic->new( -start => 3,
-end => 3,
-strand => 1,
-primary => 'hotspot',
-tag => {note => ['note3a','note3b'],
comment => 'c1'},
);
$seq2->add_SeqFeature($ft2);
$seq2->add_SeqFeature($ft3);
my $seq1_length = $seq1->length;
ok (Bio::SeqUtils->cat($seq1, $seq2));
is $seq1->seq, 'aaaattttcccctttt';
is scalar $seq1->annotation->get_Annotations, 5;
is_deeply([uniq_sort(map{$_->get_all_tags}$seq1->get_SeqFeatures)], [sort qw(note comment)], 'cat - has expected tags');
is_deeply([sort map{$_->get_tagset_values('note')}$seq1->get_SeqFeatures], [sort qw(note2 note3a note3b)], 'cat - has expected tag values');
my @tags;
lives_ok {
@tags = map{$_->get_tag_values(q(note))}$seq1->get_SeqFeatures ;
} 'cat - note tag transfered (no throw)';
cmp_ok(scalar(@tags),'==',3, 'cat - note tag values transfered (correct count)') ;
my ($ft3_precat) = grep ($_->primary_tag eq 'hotspot', $seq2->get_SeqFeatures);
is ($ft3_precat->start, 3, "get correct start of feature before 'cat'");
my ($ft3_cat) = grep ($_->primary_tag eq 'hotspot', $seq1->get_SeqFeatures);
is ($ft3_cat->start, 3+$seq1_length, "get correct start of feature after 'cat'");
my $protseq = Bio::PrimarySeq->new(-id => 2, -seq => 'MVTF'); # protein seq
throws_ok {
Bio::SeqUtils->cat($seq1, $protseq);
} qr/different alphabets:/, 'different alphabets' ;
#
# evolve()
#
$seq = Bio::PrimarySeq->new('-seq'=> 'aaaaaaaaaa',
'-id'=>'test');
$util = Bio::SeqUtils->new(-verbose => 0);
ok my $newseq = $util->evolve($seq, 60, 4);
# annotations
$seq2 = Bio::Seq->new(-id => 2, -seq => 'ggttaaaa', -description => 'second');
$ac3 = Bio::Annotation::Collection->new();
$simple3 = Bio::Annotation::SimpleValue->new(
-tagname => 'colour',
-value => 'red'
);
$ac3->add_Annotation('simple',$simple3);
$seq2->annotation($ac3);
$ft2 = Bio::SeqFeature::Generic->new( -start => 1,
-end => 4,
-strand => 1,
-primary => 'source',
-tag => {note => 'note2'},
);
$ft3 = Bio::SeqFeature::Generic->new( -start => 5,
-end => 8,
-strand => -1,
-primary => 'hotspot',
-tag => {note => ['note3a','note3b'],
comment => 'c1'},
);
my $ft4 = Bio::SeqFeature::Generic->new(-primary => 'CDS');
$ft4->location(Bio::Location::Fuzzy->new(-start=>'<1',
-end=>5,
-strand=>-1));
$seq2->add_SeqFeature($ft2);
$seq2->add_SeqFeature($ft3);
$seq2->add_SeqFeature($ft4);
my $trunc=Bio::SeqUtils->trunc_with_features($seq2, 2, 7);
is $trunc->seq, 'gttaaa';
my @feat=$trunc->get_SeqFeatures;
is $feat[0]->location->to_FTstring, '<1..3';
is $feat[1]->location->to_FTstring, 'complement(4..>6)';
is $feat[2]->location->to_FTstring, 'complement(<1..4)';
is_deeply([uniq_sort(map{$_->get_all_tags}$trunc->get_SeqFeatures)], [sort qw(note comment)], 'trunc_with_features - has expected tags');
is_deeply([sort map{$_->get_tagset_values('note')}$trunc->get_SeqFeatures], [sort qw(note2 note3a note3b)], 'trunc_with_features - has expected tag values');
my $revcom=Bio::SeqUtils->revcom_with_features($seq2);
is $revcom->seq, 'ttttaacc';
my ($rf1) = $revcom->get_SeqFeatures('hotspot');
is $rf1->primary_tag, $ft3->primary_tag, 'primary_tag matches original feature...';
is $rf1->location->to_FTstring, '1..4', 'but tagged sf is now revcom';
my ($rf2) = $revcom->get_SeqFeatures('source');
is $rf2->primary_tag, $ft2->primary_tag, 'primary_tag matches original feature...';
is $rf2->location->to_FTstring, 'complement(5..8)', 'but tagged sf is now revcom';
my ($rf3) = $revcom->get_SeqFeatures('CDS');
is $rf3->primary_tag, $ft4->primary_tag, 'primary_tag matches original feature...';
is $rf3->location->to_FTstring, '4..>8', 'but tagged sf is now revcom';
is_deeply([uniq_sort(map{$_->get_all_tags}$revcom->get_SeqFeatures)], [sort qw(note comment)], 'revcom_with_features - has expected tags');
is_deeply([sort map{$_->get_tagset_values('note')}$revcom->get_SeqFeatures], [sort qw(note2 note3a note3b)], 'revcom_with_features - has expected tag values');
# check circularity
isnt($revcom->is_circular, 1, 'still not circular');
$seq3 = Bio::Seq->new(-id => 3, -seq => 'ggttaaaa', -description => 'third', -is_circular => 1);
is(Bio::SeqUtils->revcom_with_features($seq3)->is_circular, 1, 'still circular');
# delete, insert and ligate
# prepare some sequence objects
my $seq_obj = Bio::Seq->new(
-seq =>'aaaaaaaaaaccccccccccggggggggggtttttttttt',
-display_id => 'seq1',
-desc => 'some sequence for testing'
);
my $subfeat1 = Bio::SeqFeature::Generic->new(
-primary_tag => 'sf1',
-seq_id => 'seq1',
-start => 2,
-end => 12
);
my $subfeat2 = Bio::SeqFeature::Generic->new(
-primary_tag => 'sf2',
-seq_id => 'seq1',
-start => 14,
-end => 16
);
my $subfeat3 = Bio::SeqFeature::Generic->new(
-primary_tag => 'sf3',
-seq_id => 'seq1',
-start => 21,
-end => 25
);
my $composite_feat1 = Bio::SeqFeature::Generic->new(
-primary_tag => 'comp_feat1',
-seq_id => 'seq1',
-start => 2,
-end => 30
);
my $coll_sf = Bio::Annotation::Collection->new;
$coll_sf->add_Annotation(
'comment', Bio::Annotation::Comment->new( '-text' => 'a comment on sf1')
);
$subfeat1->annotation($coll_sf);
$composite_feat1->add_SeqFeature( $subfeat1);
$composite_feat1->add_SeqFeature( $subfeat2);
$composite_feat1->add_SeqFeature( $subfeat3);
my $feature1 = Bio::SeqFeature::Generic->new(
-primary_tag => 'feat1',
-seq_id => 'seq1',
-start => 2,
-end => 25
);
my $feature2 = Bio::SeqFeature::Generic->new(
-primary_tag => 'feat2',
-seq_id => 'seq1',
-start => 15,
-end => 25,
-strand => -1,
);
my $feature3 = Bio::SeqFeature::Generic->new(
-primary_tag => 'feat3',
-seq_id => 'seq1',
-start => 30,
-end => 40
);
my $feature4 = Bio::SeqFeature::Generic->new(
-primary_tag => 'feat4',
-seq_id => 'seq1',
-start => 1,
-end => 10
);
my $feature5 = Bio::SeqFeature::Generic->new(
-primary_tag => 'feat5',
-seq_id => 'seq1',
-start => 11,
-end => 20
);
my $feature6 = Bio::SeqFeature::Generic->new(
-primary_tag => 'feat6',
-seq_id => 'seq1',
-start => 11,
-end => 25
);
$seq_obj->add_SeqFeature( $composite_feat1, $feature1, $feature2, $feature3, $feature4, $feature5, $feature6);
my $coll = Bio::Annotation::Collection->new;
$coll->add_Annotation(
'comment', Bio::Annotation::Comment->new( '-text' => 'a comment on the whole sequence')
);
$seq_obj->annotation($coll);
my $fragment_obj = Bio::Seq->new(
-seq =>'atatatatat',
-display_id => 'fragment1',
-desc => 'some fragment to insert'
);
my $frag_feature1 = Bio::SeqFeature::Generic->new(
-primary_tag => 'frag_feat1',
-seq_id => 'fragment1',
-start => 2,
-end => 4,
-strand => -1,
);
$fragment_obj->add_SeqFeature( $frag_feature1 );
my $frag_coll = Bio::Annotation::Collection->new;
$frag_coll->add_Annotation(
'comment', Bio::Annotation::Comment->new( '-text' => 'a comment on the fragment')
);
$fragment_obj->annotation($frag_coll);
# delete
my $product;
lives_ok(
sub {
$product = Bio::SeqUtils->delete( $seq_obj, 11, 20 );
},
"No error thrown when deleting a segment of the sequence"
);
my ($seq_obj_comment) = $seq_obj->annotation->get_Annotations('comment');
my ($product_comment) = $product->annotation->get_Annotations('comment');
is( $seq_obj_comment, $product_comment, 'annotation of whole sequence has been moved to new molecule');
ok(
grep ($_ eq 'deletion of 10bp',
map ($_->get_tag_values('note'),
grep ($_->primary_tag eq 'misc_feature', $product->get_SeqFeatures)
)
),
"the product has an additional 'misc_feature' and the note specifies the lengths of the deletion'"
);
my ($composite_feat1_del) = grep ($_->primary_tag eq 'comp_feat1', $product->get_SeqFeatures);
ok ($composite_feat1_del, "The composite feature is still present");
isa_ok( $composite_feat1_del, 'Bio::SeqFeature::Generic');
isa_ok( $composite_feat1_del->location, 'Bio::Location::Split', "a composite feature that spanned the deletion site has been split up, Location");
is( $composite_feat1_del->get_SeqFeatures, 2, 'one of the sub-eatures of the composite feature has been deleted completely');
my ($subfeat1_del) = grep ($_->primary_tag eq 'sf1', $composite_feat1_del->get_SeqFeatures);
ok ($subfeat1_del, "sub-feature 1 of the composite feature is still present");
is ($subfeat1->end, 12, "the original end of sf1 is 12");
is ($subfeat1_del->end, 10, "after deletion, the end of sf1 is 1nt before the deletion site");
is ($subfeat1->location->end_pos_type, 'EXACT', 'the original end location of sf1 EXACT');
my ($subfeat1_comment) = $subfeat1->annotation->get_Annotations('comment');
my ($subfeat1_del_comment) = $subfeat1_del->annotation->get_Annotations('comment');
is( $subfeat1_comment, $subfeat1_del_comment, 'annotation of subeature 1 has been moved to new molecule');
my ($feature1_del) = grep ($_->primary_tag eq 'feat1', $product->get_SeqFeatures);
ok ($feature1_del, "feature1 is till present");
isa_ok( $feature1_del->location, 'Bio::Location::Split', 'feature1 location has now been split by the deletion and location object');
is( my @feature1_del_sublocs = $feature1_del->location->each_Location, 2, 'feature1 has two locations after the deletion');
is( $feature1_del_sublocs[0]->start, 2, 'feature1 start is unaffected by the deletion');
is( $feature1_del_sublocs[0]->end, 10, 'feature1 end of first split is 1nt before deletion site');
is( $feature1_del_sublocs[1]->start, 11, 'feature1 start of second split is 1nt after deletion site');
is( $feature1_del_sublocs[1]->end, 15, 'feature1 end of second split has been adjusted correctly');
my @fd1_notes = $feature1_del->get_tag_values('note');
is( @fd1_notes,1, 'split feature now has a note');
is (shift @fd1_notes, '10bp internal deletion between pos 10 and 11', 'got the expected note about length and position of deletion');
my ($feature3_del) = grep ($_->primary_tag eq 'feat3', $product->get_SeqFeatures);
ok ($feature3_del, "feature3 is till present");
is_deeply ( [$feature3_del->start, $feature3_del->end], [$feature3->start - 10, $feature3->end - 10], 'a feature downstream of the deletion site is shifted entirely by 10nt to the left');
my ($feature4_del) = grep ($_->primary_tag eq 'feat4', $product->get_SeqFeatures);
ok ($feature4_del, "feature4 is till present");
is_deeply ( [$feature4_del->start, $feature4_del->end], [$feature4->start, $feature4->end], 'a feature upstream of the deletion site is not repositioned by the deletion');
my ($feature2_del) = grep ($_->primary_tag eq 'feat2', $product->get_SeqFeatures);
ok ($feature2_del, "feature2 is till present");
is ( $feature2_del->start, 11, 'start pos of a feature that started in the deletion site has been altered accordingly');
my @fd2_notes = $feature2_del->get_tag_values('note');
is( @fd2_notes,1, 'feature 2 now has a note');
is (shift @fd2_notes, "6bp deleted from feature 3' end", "note added to feature2 about deletion at 3' end");
ok (!grep ($_->primary_tag eq 'feat5', $product->get_SeqFeatures), 'a feature that was completely positioned inside the deletion site is not present on the new molecule');
my ($feature6_del) = grep ($_->primary_tag eq 'feat6', $product->get_SeqFeatures);
ok ($feature6_del, "feature6 is till present");
is ( $feature6_del->start, 11, 'start pos of a feature that started in the deletion site has been altered accordingly');
is ( $feature6_del->end, 15, 'end pos of a feature that started in the deletion site has been altered accordingly');
# insert
lives_ok(
sub {
$product = Bio::SeqUtils->insert( $seq_obj, $fragment_obj, 10 );
},
"No error thrown when inserting a fragment into recipient sequence"
);
($seq_obj_comment) = $seq_obj->annotation->get_Annotations('comment');
($product_comment) = $product->annotation->get_Annotations('comment');
is( $seq_obj_comment, $product_comment, 'annotation of whole sequence has been moved to new molecule');
my ($composite_feat1_ins) = grep ($_->primary_tag eq 'comp_feat1', $product->get_SeqFeatures);
ok ($composite_feat1_ins, "The composite feature is still present");
isa_ok( $composite_feat1_ins, 'Bio::SeqFeature::Generic');
isa_ok( $composite_feat1_ins->location, 'Bio::Location::Split', "a composite feature that spanned the insertion site has been split up, Location");
is( $composite_feat1_ins->get_SeqFeatures, 3, 'all of the parts of the composite feature are still present');
my ($subfeat1_ins) = grep ($_->primary_tag eq 'sf1', $composite_feat1_ins->get_SeqFeatures);
ok ($subfeat1_ins, "sub-feature 1 of the composite feature is still present");
is ($subfeat1->end, 12, "the original end of sf1 is 12");
is ($subfeat1_ins->end, $subfeat1->end + $fragment_obj->length, "after insertion, the end of sf1 has been shifted by the length of the insertion");
isa_ok( $subfeat1_ins->location, 'Bio::Location::Split', 'sub-feature 1 (spans insertion site) is now split up and');
is_deeply (
[$subfeat1->location->end_pos_type, $subfeat1->location->start_pos_type],
[$subfeat1_ins->location->end_pos_type, $subfeat1_ins->location->start_pos_type],
'the start and end position types of sub-feature1 have not changed'
);
($subfeat1_comment) = $subfeat1->annotation->get_Annotations('comment');
my ($subfeat1_ins_comment) = $subfeat1_ins->annotation->get_Annotations('comment');
is( $subfeat1_comment, $subfeat1_ins_comment, 'annotation of subeature 1 has been moved to new molecule');
my @sf1ins_notes = $subfeat1_ins->get_tag_values('note');
is( @sf1ins_notes,1, 'split feature now has a note');
is (shift @sf1ins_notes, '10bp internal insertion between pos 10 and 21', 'got the expected note about length and position of insertion');
my ($feature3_ins) = grep ($_->primary_tag eq 'feat3', $product->get_SeqFeatures);
ok ($feature3_ins, "feature3 is till present");
is_deeply (
[$feature3_ins->start, $feature3_ins->end],
[$feature3->start + $fragment_obj->length, $feature3->end + $fragment_obj->length],
'a feature downstream of the insertion site is shifted entirely to the left by the length of the insertion');
my ($feature4_ins) = grep ($_->primary_tag eq 'feat4', $product->get_SeqFeatures);
ok ($feature4_ins, "feature4 is till present");
is_deeply ( [$feature4_ins->start, $feature4_ins->end], [$feature4->start, $feature4->end], 'a feature upstream of the insertion site is not repositioned');
my ($frag_feature1_ins) = grep ($_->primary_tag eq 'frag_feat1', $product->get_SeqFeatures);
ok( $frag_feature1_ins, 'a feature on the inserted fragment is present on the product molecule');
is_deeply (
[$frag_feature1_ins->start, $frag_feature1_ins->end],
[12, 14],
'position of the feature on the insert has been adjusted to product coordinates'
);
is( $frag_feature1_ins->strand, $frag_feature1->strand, 'strand of the feature on insert has not changed');
like( $product->desc, qr/some fragment to insert/, 'desctription of the product contains description of the fragment');
like( $product->desc, qr/some sequence for testing/, 'desctription of the product contains description of the recipient');
ok(
grep ($_ eq 'inserted fragment',
map ($_->get_tag_values('note'),
grep ($_->primary_tag eq 'misc_feature', $product->get_SeqFeatures)
)
),
"the product has an additional 'misc_feature' with note='inserted fragment'"
);
# ligate
lives_ok(
sub {
$product = Bio::SeqUtils->ligate(
-recipient => $seq_obj,
-fragment => $fragment_obj,
-left => 10,
-right => 31,
-flip => 1
);
},
"No error thrown using 'ligate' of fragment into recipient"
);
is ($product->length, 30, 'product has the expected length');
is ($product->subseq(11,20), 'atatatatat', 'the sequence of the fragment is inserted into the product');
my ($inserted_fragment_feature) = grep(
grep($_ eq 'inserted fragment', $_->get_tag_values('note')),
grep( $_->has_tag('note'), $product->get_SeqFeatures)
);
ok($inserted_fragment_feature, 'we have a feature annotating the ligated fragment');
is_deeply (
[$inserted_fragment_feature->start, $inserted_fragment_feature->end],
[11, 20],
'coordinates of the feature annotating the ligated feature are correct'
);
my ($fragment_feat_lig) = grep ($_->primary_tag eq 'frag_feat1', $product->get_SeqFeatures);
ok( $fragment_feat_lig, 'the fragment feature1 is now a feature of the product');
is_deeply( [$fragment_feat_lig->start, $fragment_feat_lig->end], [17,19], 'start and end of a feature on the fragment are correct after insertion with "flip" option');
SKIP: {
skip("Storable::dclone not supported yet for Bio::SeqUtils, see ", 9) if $Bio::Root::Root::CLONE_CLASS eq 'Storable';
# test clone_obj option (create new objects via clone not 'new')
my $foo_seq_obj = Bio::Seq::Foo->new(
-seq =>'aaaaaaaaaaccccccccccggggggggggtttttttttt',
-display_id => 'seq1',
-desc => 'some sequence for testing'
);
for ($composite_feat1, $feature1, $feature2, $feature3, $feature4, $feature5) {
$foo_seq_obj->add_SeqFeature( $_ );
}
$foo_seq_obj->annotation($coll);
dies_ok(
sub {
$product = Bio::SeqUtils->delete( $foo_seq_obj, 11, 20, { clone_obj => 0} );
},
"Trying to delete from an object of a custom Bio::Seq subclass that doesn't allow calling 'new' throws an error"
);
lives_ok(
sub {
$product = Bio::SeqUtils->delete( $foo_seq_obj, 11, 20, { clone_obj => 1} );
},
"Deleting from Bio::Seq::Foo does not throw an error when using the 'clone_obj' option to clone instead of calling 'new'"
);
isa_ok( $product, 'Bio::Seq::Foo');
# just repeat some of the tests for the cloned feature
ok(
grep ($_ eq 'deletion of 10bp',
map ($_->get_tag_values('note'),
grep ($_->primary_tag eq 'misc_feature', $product->get_SeqFeatures)
)
),
"the product has an additional 'misc_feature' and the note specifies the lengths of the deletion'"
);
($composite_feat1_del) = grep ($_->primary_tag eq 'comp_feat1', $product->get_SeqFeatures);
ok ($composite_feat1_del, "The composite feature is still present");
isa_ok( $composite_feat1_del, 'Bio::SeqFeature::Generic');
isa_ok( $composite_feat1_del->location, 'Bio::Location::Split', "a composite feature that spanned the deletion site has been split up, Location");
# ligate with clone_obj
dies_ok(
sub {
$product = Bio::SeqUtils->ligate(
-recipient => $foo_seq_obj,
-fragment => $fragment_obj,
-left => 10,
-right => 31,
-flip => 1
);
},
"'ligate' without clone_obj option dies with a Bio::Seq::Foo object that can't call new"
);
lives_ok(
sub {
$product = Bio::SeqUtils->ligate(
-recipient => $foo_seq_obj,
-fragment => $fragment_obj,
-left => 10,
-right => 31,
-flip => 1,
-clone_obj => 1,
);
},
"'ligate' with clone_obj option works with a Bio::Seq::Foo object that can't call new"
);
}
sub uniq_sort {
my @args = @_;
my %uniq;
@args = sort @args;
@uniq{@args} = (0..$#args);
return sort {$uniq{$a} <=> $uniq{$b}} keys %uniq;
}
package Bio::Seq::Foo;
use base 'Bio::Seq';
sub can_call_new { 0 }