BLASTN 2.1.2 [Oct-19-2000]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= AE003528 Drosophila melanogaster genomic scaffold
142000013386050 section 40 of 54, complete sequence.
(283,821 letters)
Database: ecoli.nt
400 sequences; 4,662,239 total letters
Searching.................................................done
Score E
Sequences producing significant alignments: (bits) Value
gb|AE000450.1|AE000450 Escherichia coli K-12 MG1655 section 340 ... 60 1e-06
gb|AE000359.1|AE000359 Escherichia coli K-12 MG1655 section 249 ... 48 0.004
gb|AE000281.1|AE000281 Escherichia coli K-12 MG1655 section 171 ... 40 1.1
gb|AE000274.1|AE000274 Escherichia coli K-12 MG1655 section 164 ... 40 1.1
gb|AE000117.1|AE000117 Escherichia coli K-12 MG1655 section 7 of... 40 1.1
gb|AE000502.1|AE000502 Escherichia coli K-12 MG1655 section 392 ... 38 4.3
gb|AE000454.1|AE000454 Escherichia coli K-12 MG1655 section 344 ... 38 4.3
gb|AE000443.1|AE000443 Escherichia coli K-12 MG1655 section 333 ... 38 4.3
gb|AE000404.1|AE000404 Escherichia coli K-12 MG1655 section 294 ... 38 4.3
gb|AE000369.1|AE000369 Escherichia coli K-12 MG1655 section 259 ... 38 4.3
gb|AE000287.1|AE000287 Escherichia coli K-12 MG1655 section 177 ... 38 4.3
gb|AE000283.1|AE000283 Escherichia coli K-12 MG1655 section 173 ... 38 4.3
gb|AE000253.1|AE000253 Escherichia coli K-12 MG1655 section 143 ... 38 4.3
gb|AE000201.1|AE000201 Escherichia coli K-12 MG1655 section 91 o... 38 4.3
>gb|AE000450.1|AE000450 Escherichia coli K-12 MG1655 section 340 of 400 of the complete genome
Length = 11414
Score = 60.0 bits (30), Expect = 1e-06
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 79116 gacatcatcgccattctgggaatggatgaactgtctga 79153
|||||||||||||| ||||| |||||||||||||||||
Sbjct: 4712 gacatcatcgccatcctgggtatggatgaactgtctga 4675
Score = 40.1 bits (20), Expect = 1.1
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 78617 tggccagatgaacgagcccccggg 78640
|||||||||||||||||| |||||
Sbjct: 5208 tggccagatgaacgagccgccggg 5185
>gb|AE000359.1|AE000359 Escherichia coli K-12 MG1655 section 249 of 400 of the complete genome
Length = 11001
Score = 48.1 bits (24), Expect = 0.004
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 193000 tgttgctgctgttgcagattgctg 193023
||||||||||||||||||||||||
Sbjct: 10696 tgttgctgctgttgcagattgctg 10673
>gb|AE000281.1|AE000281 Escherichia coli K-12 MG1655 section 171 of 400 of the complete genome
Length = 11855
Score = 40.1 bits (20), Expect = 1.1
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 211974 ataaatatgtgcaccattagtaac 211997
|||||||||||| |||||||||||
Sbjct: 3068 ataaatatgtgcgccattagtaac 3091
>gb|AE000274.1|AE000274 Escherichia coli K-12 MG1655 section 164 of 400 of the complete genome
Length = 13793
Score = 40.1 bits (20), Expect = 1.1
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 227803 ctggagatgctggaaatgctcact 227826
|||||||||||||||||| |||||
Sbjct: 3532 ctggagatgctggaaatggtcact 3555
>gb|AE000117.1|AE000117 Escherichia coli K-12 MG1655 section 7 of 400 of the complete genome
Length = 13416
Score = 40.1 bits (20), Expect = 1.1
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 2754 gctgctgctgttgctgccac 2773
||||||||||||||||||||
Sbjct: 3441 gctgctgctgttgctgccac 3422
>gb|AE000502.1|AE000502 Escherichia coli K-12 MG1655 section 392 of 400 of the complete genome
Length = 11313
Score = 38.2 bits (19), Expect = 4.3
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 171913 ttttatgtagattttacttgtta 171935
|||||||| ||||||||||||||
Sbjct: 428 ttttatgttgattttacttgtta 450
>gb|AE000454.1|AE000454 Escherichia coli K-12 MG1655 section 344 of 400 of the complete genome
Length = 12175
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 176663 agacaaatttatgagcgtt 176681
|||||||||||||||||||
Sbjct: 9769 agacaaatttatgagcgtt 9751
>gb|AE000443.1|AE000443 Escherichia coli K-12 MG1655 section 333 of 400 of the complete genome
Length = 11577
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 160348 gcatttgttgtttgcggac 160366
|||||||||||||||||||
Sbjct: 8826 gcatttgttgtttgcggac 8844
>gb|AE000404.1|AE000404 Escherichia coli K-12 MG1655 section 294 of 400 of the complete genome
Length = 14000
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 193629 ttagcgaccaccacgtcgg 193647
|||||||||||||||||||
Sbjct: 13496 ttagcgaccaccacgtcgg 13478
>gb|AE000369.1|AE000369 Escherichia coli K-12 MG1655 section 259 of 400 of the complete genome
Length = 9720
Score = 38.2 bits (19), Expect = 4.3
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 50797 catcaatattattgaatatttca 50819
||||| |||||||||||||||||
Sbjct: 869 catcactattattgaatatttca 847
>gb|AE000287.1|AE000287 Escherichia coli K-12 MG1655 section 177 of 400 of the complete genome
Length = 10876
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 94068 tcaccagccagccgctgcc 94086
|||||||||||||||||||
Sbjct: 443 tcaccagccagccgctgcc 461
>gb|AE000283.1|AE000283 Escherichia coli K-12 MG1655 section 173 of 400 of the complete genome
Length = 10857
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 104663 acgttagcggcactgactc 104681
|||||||||||||||||||
Sbjct: 893 acgttagcggcactgactc 875
>gb|AE000253.1|AE000253 Escherichia coli K-12 MG1655 section 143 of 400 of the complete genome
Length = 10582
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 191578 cgttgaaaatggaaatctt 191596
|||||||||||||||||||
Sbjct: 2595 cgttgaaaatggaaatctt 2577
>gb|AE000201.1|AE000201 Escherichia coli K-12 MG1655 section 91 of 400 of the complete genome
Length = 11275
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 249230 tggctgctgctccagttgt 249248
|||||||||||||||||||
Sbjct: 2297 tggctgctgctccagttgt 2315
Database: ecoli.nt
Posted date: Jun 14, 2001 3:27 PM
Number of letters in database: 4,662,239
Number of sequences in database: 400
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 592338
Number of Sequences: 400
Number of extensions: 592338
Number of successful extensions: 42599
Number of sequences better than 10.0: 14
length of query: 283821
length of database: 4,662,239
effective HSP length: 20
effective length of query: 283801
effective length of database: 4,654,239
effective search space: 1320877682439
effective search space used: 1320877682439
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 10 (19.8 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)