/usr/local/fasta3/bin/fasta35 -O test_revcomp.fasta35 test_revcomp.fa clusters.fasta
FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26, 2009
Please cite:
W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
Query: ILTV-miR1, 70 nt
1>>>ILTV-miR1 - 70 nt - 70 nt
Library: clusters.fasta 3924656 residues in 179575 sequences
opt E()
< 20 8261 0:==============================
22 16 0:= one = represents 279 library sequences
24 5 0:=
26 38 4:*
28 262 41:*
30 712 247:*==
32 1499 956:===*==
34 4618 2593:=========*=======
36 5199 5325:===================*
38 7360 8800:=========================== *
40 9090 12276:================================= *
42 15194 15005:=====================================================*=
44 16710 16552:===========================================================*
46 14217 16859:=================================================== *
48 11294 16141:========================================= *
50 13398 14728:================================================= *
52 14142 12949:==============================================*====
54 10605 11060:=======================================*
56 6654 9239:======================== *
58 7042 7585:========================== *
60 7276 6144:======================*====
62 9388 4926:=================*================
64 3357 3918:============= *
66 3240 3096:===========*
68 3655 2435:========*=====
70 1842 1909:======*
72 1001 1491:==== *
74 718 1163:=== *
76 747 905:===*
78 478 703:==*
80 334 546:=*
82 284 418:=*
84 196 331:=*
86 156 256:*
88 126 198:* inset = represents 2 library sequences
90 96 153:*
92 79 119:* :=======================================*
94 47 92:* :======================== *
96 40 71:* :==================== *
98 33 55:* :================= *
100 24 43:* :============ *
102 12 33:* :====== *
104 15 25:* :======== *
106 9 20:* :===== *
108 6 15:* :=== *
110 0 12:* : *
112 0 9:* : *
114 1 7:* := *
116 1 5:* := *
118 1 4:* :=*
>120 94 3:* :=*======================================
3924656 residues in 179575 sequences
Statistics: Expectation_n fit: rho(ln(x))= 6.7921+/-0.000406; mu= 7.9651+/- 0.013
mean_var=36.4967+/-12.281, 0's: 2734 Z-trim: 2761 B-trim: 0 in 0/14
Lambda= 0.212299
statistics sampled from 60000 to 179478 sequences
Kolmogorov-Smirnov statistic: 0.0718 (N=29) at 58
Algorithm: FASTA (3.5 Sept 2006) [optimized]
Parameters: +5/-4 matrix (5:-4) ktup: 3
join: 60, opt: 45, open/ext: -12/-4, width: 16
The best scores are: opt bits E(179572)
cluster_79238:1 ( 27) [r] 126 41.0 0.00012
>>cluster_79238:1 (27 nt)
rev-comp initn: 125 init1: 125 opt: 126 Z-score: 208.3 bits: 41.0 E(): 0.00012
banded Smith-Waterman score: 126; 96.3% identity (96.3% similar) in 27 nt overlap (29-3:1-27)
60 50 40 30 20 10
ILTV-- TGATTGGGGAATGATTGGGAAGCTTGTGCCAATTCCATTCCTCTTTCTGTCTCCACCGC
::::::::::::::::::::::::: :
cluste AATTCCATTCCTCTTTCTGTCTCCAAC
10 20
70 residues in 1 query sequences
3924656 residues in 179575 library sequences
Scomplib [35.04]
start: Tue Oct 27 08:58:20 2009 done: Tue Oct 27 08:58:25 2009
Total Scan time: 1.360 Total Display time: 0.000
Function used was FASTA [version 35.04 Mar. 26, 2009]