The Perl Toolchain Summit needs more sponsors. If your company depends on Perl, please support this very important event.
BLASTN 2.2.16 [Mar-25-2007]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Callithrix_jacchus Callithrix jacchus clone CH259-179B5,
WORKING DRAFT SEQUENCE, 15 ordered pieces.
         (38,526 letters)

Database: blast1 
           1 sequences; 247,249,719 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

chr1                                                                 3971   0.0  

>chr1
          Length = 247249719

 Score = 3971 bits (2039), Expect = 0.0
 Identities = 2927/3229 (90%), Gaps = 63/3229 (1%)
 Strand = Plus / Plus

                                                                            
Query: 29757    acaaacacatccaggtgaaccccaacccccagcccaaaaaggtaagtctgttgtatttac 29816
                |||| ||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||
Sbjct: 27202976 acaagcacatccaggtgaactccaccccccagcccaaaaaggtaagtctgttgtgtttac 27203035

(truncated, not supposed to parse fully)