The Perl Toolchain Summit needs more sponsors. If your company depends on Perl, please support this very important event.
use strict;
use warnings;

use Test::More tests => 9;

# 1
use_ok('Bio::Polloc::Rule::repeat');
use_ok('Bio::Seq');

# -------------------------------------------- repeat
SKIP: {
skip 'mreps not installed', 7 unless Bio::Polloc::Rule::repeat->_executable;

# 3
my $r = Bio::Polloc::RuleI->new(-type=>'repeat');
isa_ok($r, 'Bio::Polloc::Rule::repeat');

# 4
$r->value({	-minsize => 3,
		-minperiod => 2,
		-minexponent => 3});
my $loci = $r->execute(-seq=>Bio::Seq->new(-seq=>'CCCACTGACTGACTGACTGACTGACTGGGGTACGTTAGCCCC'));
isa_ok($loci, 'ARRAY');
is($#$loci, 0, 'Correct number of loci');

# 6
isa_ok($loci->[0], 'Bio::Polloc::Locus::repeat');
is($loci->[0]->from, 4, 'Correct origin of locus 1');
is($loci->[0]->strand, '+', 'Correct strand of locus 1');
is($loci->[0]->score, 100, 'Correct score of locus 1');

}