
Bio::Perl - Functional access to BioPerl for people who don't know objects

use Bio::Perl;
# will guess file format from extension
$seq_object = read_sequence($filename);
# forces genbank format
$seq_object = read_sequence($filename,'genbank');
# reads an array of sequences
@seq_object_array = read_all_sequences($filename,'fasta');
# sequences are Bio::Seq objects, so the following methods work
# for more info see Bio::Seq, or do 'perldoc Bio/Seq.pm'
print "Sequence name is ",$seq_object->display_id,"\n";
print "Sequence acc is ",$seq_object->accession_number,"\n";
print "First 5 bases is ",$seq_object->subseq(1,5),"\n";
# get the whole sequence as a single string
$sequence_as_a_string = $seq_object->seq();
# writing sequences
write_sequence(">$filename",'genbank',$seq_object);
write_sequence(">$filename",'genbank',@seq_object_array);
# making a new sequence from just a string
$seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA",
"myname","AL12232");
# getting a sequence from a database (assumes internet connection)
$seq_object = get_sequence('swissprot',"ROA1_HUMAN");
$seq_object = get_sequence('embl',"AI129902");
$seq_object = get_sequence('genbank',"AI129902");
# BLAST a sequence (assummes an internet connection)
$blast_report = blast_sequence($seq_object);
write_blast(">blast.out",$blast_report);

Easy first time access to BioPerl via functions

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bio.perl.org
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via email or the web:
bioperl-bugs@bio.perl.org http://bugzilla.bioperl.org/

Email bioperl-l@bio.perl.org
Describe contact details here

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _
Title : read_sequence
Usage : $seq = read_sequence('sequences.fa')
$seq = read_sequence($filename,'genbank');
# pipes are fine
$seq = read_sequence("my_fetching_program $id |",'fasta');
Function: Reads the top sequence from the file. If no format is given, it will
try to guess the format from the filename. If a format is given, it
forces that format. The filename can be any valid perl open() string
- in particular, you can put in pipes
Returns : A Bio::Seq object. A quick synopsis:
$seq_object->display_id - name of the sequence
$seq_object->seq - sequence as a string
Args : Two strings, first the filename - any Perl open() string is ok
Second string is the format, which is optional
For more information on Seq objects see Bio::Seq.
Title : read_all_sequences
Usage : @seq_object_array = read_all_sequences($filename);
@seq_object_array = read_all_sequences($filename,'genbank');
Function: Just as the function above, but reads all the sequences in the
file and loads them into an array.
For very large files, you will run out of memory. When this
happens, you've got to use the SeqIO system directly (this is
not so hard! Don't worry about it!).
Returns : array of Bio::Seq objects
Args : two strings, first the filename (any open() string is ok)
second the format (which is optional)
See Bio::SeqIO and Bio::Seq for more information
Title : write_sequence
Usage : write_sequence(">new_file.gb",'genbank',$seq)
write_sequence(">new_file.gb",'genbank',@array_of_sequence_objects)
Function: writes sequences in the specified format
Returns : true
Args : filename as a string, must provide an open() output file
format as a string
one or more sequence objects
Title : new_sequence Usage : Function: Example : Returns : Args :
Title : blast_sequence
Usage : $blast_result = blast_sequence($seq)
$blast_result = blast_sequence('MFVEGGTFASEDDDSASAEDE');
Function: If the computer has Internet accessibility, blasts
the sequence using the NCBI BLAST server against nrdb.
It chooses the flavour of BLAST on the basis of the sequence.
This function uses Bio::Tools::Run::RemoteBlast, which itself
use Bio::SearchIO - as soon as you want to know more, check out
these modules
Returns : Bio::Search::Result::GenericResult.pm
Args : Either a string of protein letters or nucleotides, or a
Bio::Seq object
Title : write_blast
Usage : write_blast($filename,$blast_report);
Function: Writes a BLAST result object (or more formally
a SearchIO result object) out to a filename
in BLAST-like format
Returns : none
Args : filename as a string
Bio::SearchIO::Results object
Title : get_sequence
Usage : $seq_object = get_sequence('swiss',"ROA1_HUMAN");
Function: If the computer has Internet accessibility, gets
the sequence from Internet accessible databases. Currently
this supports Swissprot, EMBL, GenBank and RefSeq.
Swissprot and EMBL are more robust than GenBank fetching.
If the user is trying to retrieve a RefSeq entry from
GenBank/EMBL, the query is silently redirected.
Returns : A Bio::Seq object
Args : database type - one of swiss, embl, genbank or refseq
identifier or accession number
Title : translate
Usage : $seqobj = translate($seq_or_string_scalar)
Function: translates a DNA sequence object OR just a plain
string of DNA to amino acids
Returns : A Bio::Seq object
Args : Either a sequence object or a string of
just DNA sequence characters
Title : translate_as_string
Usage : $seqstring = translate_as_string($seq_or_string_scalar)
Function: translates a DNA sequence object OR just a plain
string of DNA to amino acids
Returns : A stirng of just amino acids
Args : Either a sequence object or a string of
just DNA sequence characters
Title : reverse_complement
Usage : $seqobj = reverse_complement($seq_or_string_scalar)
Function: reverse complements a string or sequence argument
producing a Bio::Seq - if you want a string, you
can use reverse_complement_as_string
Returns : A Bio::Seq object
Args : Either a sequence object or a string of
just DNA sequence characters
Title : revcom
Usage : $seqobj = revcom($seq_or_string_scalar)
Function: reverse complements a string or sequence argument
producing a Bio::Seq - if you want a string, you
can use reverse_complement_as_string
This is an alias for reverse_complement
Returns : A Bio::Seq object
Args : Either a sequence object or a string of
just DNA sequence characters
Title : reverse_complement_as_string
Usage : $string = reverse_complement_as_string($seq_or_string_scalar)
Function: reverse complements a string or sequence argument
producing a string
Returns : A string of DNA letters
Args : Either a sequence object or a string of
just DNA sequence characters
Title : revcom_as_string
Usage : $string = revcom_as_string($seq_or_string_scalar)
Function: reverse complements a string or sequence argument
producing a string
Returns : A string of DNA letters
Args : Either a sequence object or a string of
just DNA sequence characters