Ewan Birney > bioperl-1.4 > Bio::Tools::Run::StandAloneBlast

Download:
bioperl-1.4.tar.gz

Dependencies

Annotate this POD

CPAN RT

New  1
Open  0
View Bugs
Report a bug
Source   Latest Release: bioperl-1.5.2_102

NAME ^

Bio::Tools::Run::StandAloneBlast - Object for the local execution of the NCBI Blast program suite (blastall, blastpgp, bl2seq). There is experimental support for WU-Blast.

SYNOPSIS ^

 # Local-blast "factory object" creation and blast-parameter
 # initialization:

 @params = ('database' => 'swissprot','outfile' => 'blast1.out', 
            '_READMETHOD' => 'Blast');

 $factory = Bio::Tools::Run::StandAloneBlast->new(@params);

 # Blast a sequence against a database:

 $str = Bio::SeqIO->new(-file=>'t/amino.fa' , '-format' => 'Fasta' );
 $input = $str->next_seq();
 $input2 = $str->next_seq();
 $blast_report = $factory->blastall($input);

 # Run an iterated Blast (psiblast) of a sequence against a database:

 $factory->j(3);    # 'j' is blast parameter for # of iterations
 $factory->outfile('psiblast1.out');
 $factory = Bio::Tools::Run::StandAloneBlast->new(@params);
 $blast_report = $factory->blastpgp($input);

 # Use blast to align 2 sequences against each other:

 $factory = Bio::Tools::Run::StandAloneBlast->new('outfile' => 'bl2seq.out');
 $factory->bl2seq($input, $input2);

  #experimental support for WU-Blast 2.0
  my $factory= Bio::Tools::Run::StandAloneBlast->new('program'=>"wublastp",
                                                     'database'=>"swissprot",
                                                     'E'=>1e-20); 
  my $blast_report = $factory->wublast($seq);

 # Various additional options and input formats are available.  See
 # the DESCRIPTION section for details.

DESCRIPTION ^

This DESCRIPTION only documents Bio::Tools::Run::StandAloneBlast: - a Bioperl object for running the NCBI standAlone BLAST package. Blast, itself, is a large & complex program - for more information regarding BLAST, please see the BLAST documentation which accompanies the BLAST distribution. BLAST is available from ftp://ncbi.nlm.nih.gov/blast/.

(A source of confusion in documenting a BLAST interface is that the term "program" is used in - at least - three different ways in the BLAST documentation. In this DESCRIPTION, "program" will refer to the BLAST routine set by BLAST's -p parameter that can be set to blastn, blastp, tblastx etc. We will use the term Blast "executable" to refer to the various different executable files that may be called - ie blastall, blastpgp or bl2seq. In addition, there are several BLAST capabilities (which are also referred to as "programs") and are implemented by using specific combinations of BLAST executables, programs and parameters. They will be referred by their specific names - eg PSIBLAST and PHIBLAST. )

StandAloneBlast has been tested so far only under Linux. I expect that it should also work under other Unix systems. However, since the module is implemented using (unix) system calls, modification may be necessary before StandAloneBlast would work under non-Unix operating systems (eg Windows, MacOS). Before running StandAloneBlast it is necessary: to install BLAST on your system, to edit set the environmental variable $BLASTDIR or your $PATH variable to point to the BLAST directory, and to ensure that users have execute privileges for the BLAST program. If the databases which will be searched by BLAST are located in the data subdirectory of the blast program directory (the default installation location), StandAloneBlast will find them; however, if the database files are located in any other location, environmental variable $BLASTDATADIR will need to be set to point to that directory.

The use of the StandAloneBlast module is as follows: Initially, a local blast "factory object" is created. The constructor may be passed an optional array of (non-default) parameters to be used by the factory, eg:

 @params = ('program' => 'blastn', 'database' => 'ecoli.nt');
 $factory = Bio::Tools::Run::StandAloneBlast->new(@params);

Any parameters not explicitly set will remain as the defaults of the BLAST executable. Note each BLAST executable has somewhat different parameters and options. See the BLAST Documentation for a description or run the BLAST executable from the command line followed solely with a "-" to see a list of options and default values for that executable; eg >blastall -.

BLAST parameters can be changed and/or examined at any time after the factory has been created. The program checks that any parameter/switch being set/read is valid. Except where specifically noted, StandAloneBlast uses the same single-letter, case-sensitive parameter names as the actual blast program. Currently no checks are included to verify that parameters are of the proper type (eg string or numeric) or that their values are within the proper range.

As an example, to change the value of the Blast parameter 'e' ('e' is the parameter for expectation-value cutoff)

 $expectvalue = 0.01;
 $factory->e($expectvalue);

Note that for improved script readibility one can modify the name of the BLAST parameters as desired as long as the initial letter (and case) of the parameter are preserved, eg $factory->expectvalue($expectvalue); Unfortunately, some of the BLAST parameters are not the single letter one might expect (eg "iteration round" in blastpgp is 'j'). Again one can check by using (eg)

 > blastpgp - .

Once the factory has been created and the appropriate parameters set, one can call one of the supported blast executables. The input sequence(s) to these executables may be fasta file(s) as described in the BLAST documentation.

 $inputfilename = 't/testquery.fa';
 $blast_report = $factory->blastall($inputfilename);

In addition, sequence input may be in the form of either a Bio::Seq object or or an array of Bio::Seq objects, eg

 $input = Bio::Seq->new(-id=>"test query",-seq=>"ACTACCCTTTAAATCAGTGGGGG");
 $blast_report = $factory->blastall($input);

For blastall and non-psiblast blastpgp runs, report object is either a BPlite.pm or Bio::SearchIO object, selected by the user with the parameter _READMETHOD. (The leading underscore is needed to distinguish this option from options which are passed to the BLAST executable.) The default parser is Bio::SearchIO::blast. For (multiple iteration) psiblast and bl2seq runs the report is automatically parsed by the BPpsilite.pm and BPbl2seq.pm parsers respectively, since neither Blast.pm nor BPlite can parse these reports. In any case, the "raw" blast report is also available. The filename is set by the in the 'outfile' parameter and has the default value of "blastreport.out".

For psiblast execution in BLAST's "jumpstart" mode, the program must be passed (in addition to the query sequence itself) an alignment containing the query sequence (in the form of a SimpleAlign object) as well as a "mask" specifying at what residues position-specific scoring matrices (PSSMs) are to used and at what residues default scoring matrices (eg BLOSUM) are to be used. See psiblast documentation for more details. The mask itself is a string of 0's and 1's which is the same length as each sequence in the alignment and has a "1" at locations where (PSSMs) are to be used and a "0" at all other locations. So for example:

 $str = Bio::AlignIO->new(-file=> "cysprot.msf", '-format' => 'msf'  );
 $aln = $str->next_aln();
 $len = $aln->length_aln();
 $mask =   '1' x $len;  # simple case where PSSM's to be used at all residues
 $report = $factory->blastpgp("cysprot1.fa", $aln, $mask);

For bl2seq execution, StandAloneBlast.pm can be combined with AlignIO.pm to directly produce a SimpleAlign object from the alignment of the two sequences produced by bl2seq as in:

 #Get 2 sequences
 $str = Bio::SeqIO->new(-file=>'t/amino.fa' , '-format' => 'Fasta', );
 my $seq3 = $str->next_seq();
 my $seq4 = $str->next_seq();

 # Run bl2seq on them
 $factory = Bio::Tools::Run::StandAloneBlast->new('outfile' => 'bl2seq.out');
 my $bl2seq_report = $factory->bl2seq($seq3, $seq4);

 # Use AlignIO.pm to create a SimpleAlign object from the bl2seq report
 $str = Bio::AlignIO->new(-file=> 'bl2seq.out','-format' => 'bl2seq');
 $aln = $str->next_aln();

For more examples of syntax and use of Blast.pm, the user is encouraged to run the scripts standaloneblast.pl in the bioperl /examples directory and StandAloneBlast.t in the bioperl /t directory.

Note: There is a similar (but older) perl object interface offered by nhgri. The nhgri module only supports blastall and does not support blastpgp, psiblast, phiblast, bl2seq etc. This module can be found at http://genome.nhgri.nih.gov/blastall/.

DEVELOPERS NOTES ^

STILL TO BE WRITTEN

Note: This module is still under development. If you would like that a specific BLAST feature be added to this perl interface, let me know.

FEEDBACK ^

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.

  bioperl-l@bioperl.org               - General discussion
  http://bio.perl.org/MailList.html   - About the mailing lists

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via email or the web:

  bioperl-bugs@bio.perl.org
  http://bio.perl.org/bioperl-bugs/

AUTHOR - Peter Schattner ^

Email schattner@alum.mit.edu

APPENDIX ^

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

BLAST parameters ^

Essentially all BLAST parameter can be set via StandAloneBlast.pm. Some of the most commonly used parameters are listed below. All parameters have defaults and are optional (I think.) For a complete listing of settable parameters, run the relevant executable BLAST program with the option "-" as in blastall -

Blastall

  -p  Program Name [String]
        Input should be one of "blastp", "blastn", "blastx", 
        "tblastn", or "tblastx".
  -d  Database [String] default = nr
        The database specified must first be formatted with formatdb.
        Multiple database names (bracketed by quotations) will be accepted.
        An example would be -d "nr est"
  -i  Query File [File In]   Set by StandAloneBlast.pm from script.
    default = stdin. The query should be in FASTA format.  If multiple FASTA entries are in the input
        file, all queries will be searched.
  -e  Expectation value (E) [Real] default = 10.0
  -o  BLAST report Output File [File Out]  Optional,
        default = ./blastreport.out ; set by StandAloneBlast.pm         
  -S  Query strands to search against database (for blast[nx], and tblastx).  3 is both, 1 is top, 2 is bottom [Integer]
        default = 3

Blastpgp (including Psiblast)

  -j   is the maximum number of rounds (default 1; i.e., regular BLAST)
  -h   is the e-value threshold for including sequences in the
        score matrix model (default 0.001)
  -c   is the "constant" used in the pseudocount formula specified in the paper (default 10)
  -B  Multiple alignment file for PSI-BLAST "jump start mode"  Optional
  -Q  Output File for PSI-BLAST Matrix in ASCII [File Out]  Optional

Bl2seq

  -i  First sequence [File In]
  -j  Second sequence [File In]
  -p  Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String]
    default = blastp
  -o  alignment output file [File Out] default = stdout
  -e  Expectation value (E) [Real]  default = 10.0
  -S  Query strands to search against database (blastn only).  3 is both, 1 is top, 2 is bottom [Integer]
    default = 3

WU-Blast

  -p Program Name [String] 
        Input should be one of "wublastp", "wublastn", "wublastx", 
        "wutblastn", or "wutblastx".
  -d  Database [String] default = nr
        The database specified must first be formatted with xdformat.
  -i  Query File [File In]   Set by StandAloneBlast.pm from script.
    default = stdin. The query should be in FASTA format.  If multiple FASTA entries are in the input
        file, all queries will be searched.
  -E  Expectation value (E) [Real] default = 10.0
  -o  BLAST report Output File [File Out]  Optional,
        default = ./blastreport.out ; set by StandAloneBlast.pm         

Methods ^

executable

 Title   : executable
 Usage   : my $exe = $blastfactory->executable('blastall');
 Function: Finds the full path to the 'codeml' executable
 Returns : string representing the full path to the exe
 Args    : [optional] name of executable to set path to 
           [optional] boolean flag whether or not warn when exe is not found

program_path

 Title   : program_path
 Usage   : my $path = $factory->program_path();
 Function: Builds path for executable 
 Returns : string representing the full path to the exe
 Args    : none

program_dir

 Title   : program_dir
 Usage   : my $dir = $factory->program_dir();
 Function: Abstract get method for dir of program. To be implemented
           by wrapper.
 Returns : string representing program directory 
 Args    : none 

blastall

 Title   : blastall
 Usage   :  $blast_report = $factory->blastall('t/testquery.fa');
        or
               $input = Bio::Seq->new(-id=>"test query",
                                      -seq=>"ACTACCCTTTAAATCAGTGGGGG");
               $blast_report = $factory->blastall($input);
        or 
              $seq_array_ref = \@seq_array;  # where @seq_array is an array of Bio::Seq objects
              $blast_report = $factory->blastall(\@seq_array);
 Returns :  Reference to a Blast object or BPlite object 
           containing the blast report.
 Args    : Name of a file or Bio::Seq object or an array of 
           Bio::Seq object containing the query sequence(s). 
           Throws an exception if argument is not either a string 
           (eg a filename) or a reference to a Bio::Seq object 
           (or to an array of Seq objects).  If argument is string, 
           throws exception if file corresponding to string name can 
           not be found.

wublast

 Title   : wublast
 Usage   :  $blast_report = $factory->wublast('t/testquery.fa');
        or
               $input = Bio::Seq->new(-id=>"test query",
                                      -seq=>"ACTACCCTTTAAATCAGTGGGGG");
               $blast_report = $factory->wublast($input);
        or 
              $seq_array_ref = \@seq_array;  # where @seq_array is an array of Bio::Seq objects
              $blast_report = $factory->wublast(\@seq_array);
 Returns :  Reference to a Blast object 
 Args    : Name of a file or Bio::Seq object or an array of 
           Bio::Seq object containing the query sequence(s). 
           Throws an exception if argument is not either a string 
           (eg a filename) or a reference to a Bio::Seq object 
           (or to an array of Seq objects).  If argument is string, 
           throws exception if file corresponding to string name can 
           not be found.

blastpgp

 Title   : blastpgp
 Usage   :  $blast_report = $factory-> blastpgp('t/testquery.fa');
        or
               $input = Bio::Seq->new(-id=>"test query",
                                      -seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
               $blast_report = $factory->blastpgp ($input);
        or 
              $seq_array_ref = \@seq_array;  # where @seq_array is an array of Bio::Seq objects
              $blast_report = $factory-> blastpgp(\@seq_array);
 Returns : Reference to a Blast object or BPlite object containing 
           the blast report.
 Args    : Name of a file or Bio::Seq object. In psiblast jumpstart 
           mode two additional arguments are required: a SimpleAlign 
           object one of whose elements is the query and a "mask" to 
           determine how BLAST should select scoring matrices see 
           DESCRIPTION above for more details.

           Throws an exception if argument is not either a string 
           (eg a filename) or a reference to a Bio::Seq object 
           (or to an array of Seq objects).  If argument is string, 
           throws exception if file corresponding to string name can 
           not be found.
 Returns : Reference to either a BPlite.pm, Blast.pm or BPpsilite.pm  
           object containing the blast report.

bl2seq

 Title   : bl2seq
 Usage   : $factory-> blastpgp('t/seq1.fa', 't/seq2.fa');
        or
          $input1 = Bio::Seq->new(-id=>"test query1",
                                  -seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
          $input2 = Bio::Seq->new(-id=>"test query2",
                                  -seq=>"ACTADDEMMMMMMMDEEQQQVVGG");
          $blast_report = $factory->bl2seq ($input1,  $input2);
 Returns : Reference to a BPbl2seq object containing the blast report.
 Args    : Names of 2 files  or 2 Bio::Seq objects containing the 
           sequences to be aligned by bl2seq.

           Throws an exception if argument is not either a pair of 
           strings (eg filenames) or  references to Bio::Seq objects.  
           If arguments are strings, throws exception if files 
           corresponding to string names can not be found.

_generic_local_blast

 Title   : _generic_local_blast
 Usage   :  internal function not called directly
 Returns :  Blast or BPlite object
 Args    :   Reference to calling object and name of BLAST executable 

_generic_local_wublast

 Title   : _generic_local_wublast
 Usage   :  internal function not called directly
 Returns :  Blast object
 Args    :   Reference to calling object and name of BLAST executable 

_runblast

 Title   :  _runblast
 Usage   :  Internal function, not to be called directly        
 Function:   makes actual system call to Blast program
 Example :
 Returns : Report object in the appropriate format (BPlite, 
           BPpsilite, Blast, or BPbl2seq)
 Args    : Reference to calling object, name of BLAST executable, 
           and parameter string for executable 

_runwublast

 Title   :  _runwublast
 Usage   :  Internal function, not to be called directly        
 Function:   makes actual system call to WU-Blast program
 Example :
 Returns : Report Blast object
 Args    : Reference to calling object, name of BLAST executable, 
           and parameter string for executable 

_setinput

 Title   :  _setinput
 Usage   :  Internal function, not to be called directly        
 Function:   Create input file(s) for Blast executable
 Example :
 Returns : name of file containing Blast data input
 Args    : Seq object reference or input file name

_setparams

 Title   : _setparams
 Usage   : Internal function, not to be called directly 
 Function: Create parameter inputs for Blast program
 Example :
 Returns : parameter string to be passed to Blast 
 Args    : Reference to calling object and name of BLAST executable

Bio::Tools::Run::Wrapper methods ^

no_param_checks

 Title   : no_param_checks
 Usage   : $obj->no_param_checks($newval)
 Function: Boolean flag as to whether or not we should
           trust the sanity checks for parameter values  
 Returns : value of no_param_checks
 Args    : newvalue (optional)

save_tempfiles

 Title   : save_tempfiles
 Usage   : $obj->save_tempfiles($newval)
 Function: 
 Returns : value of save_tempfiles
 Args    : newvalue (optional)

outfile_name

 Title   : outfile_name
 Usage   : my $outfile = $tcoffee->outfile_name();
 Function: Get/Set the name of the output file for this run
           (if you wanted to do something special)
 Returns : string
 Args    : [optional] string to set value to

tempdir

 Title   : tempdir
 Usage   : my $tmpdir = $self->tempdir();
 Function: Retrieve a temporary directory name (which is created)
 Returns : string which is the name of the temporary directory
 Args    : none

cleanup

 Title   : cleanup
 Usage   : $tcoffee->cleanup();
 Function: Will cleanup the tempdir directory after a PAML run
 Returns : none
 Args    : none

io

 Title   : io
 Usage   : $obj->io($newval)
 Function:  Gets a L<Bio::Root::IO> object
 Returns : L<Bio::Root::IO>
 Args    : none