Christopher Fields > BioPerl-1.6.1 > Bio::Map::Microsatellite



Annotate this POD


New  9
Open  4
View/Report Bugs
Module Version: 1.006001   Source   Latest Release: BioPerl-1.6.923


Bio::Map::Microsatellite - An object representing a Microsatellite marker.


  $o_usat = Bio::Map::Microsatellite->new
      (-name=>'Chad Super Marker 2',
       -sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga',
       -motif => 'at',
       -repeats => 15,
       -repeat_start_position => 11

  $sequence_before_usat = $o_usat->get_leading_flank();
  $sequence_after_usat = $o_usat->get_trailing_flank();


This object handles the notion of an Microsatellite. This microsatellite can be placed on a (linear) Map or used on its own. If this Microsatellites will be used in a mapping context (it doesn't have to, you know) it can have multiple positions in a map. For information about a Microsatellite's position in a map one must query the associate PositionI object which is accessible through the position() method.


Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the Bioperl mailing list. Your participation is much appreciated.                  - General discussion  - About the mailing lists


Please direct usage questions or support issues to the mailing list:

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track of the bugs and their resolution. Bug reports can be submitted via the web:

AUTHOR - Chad Matsalla ^



Heikki Lehvaslaiho heikki-at-bioperl-dot-org Lincoln Stein Jason Stajich Sendu Bala


The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _


 Title   : new
 Usage   : $o_usat = 
 Function: Builds a new Bio::Map::Microsatellite object
 Returns : Bio::Map::Microsatellite
 Args    :
        -name    => name of this microsatellite (optional, string,
                default 'Unknown microsatellite')
        -positions => position(s) for this marker in maps[optional],
                An array reference of tuples (array refs themselves)
                Each tuple conatins a Bio::Map::MapI-inherited object and a 
                Bio::Map::PositionI-inherited obj, no default)
        -sequence => the sequence of this microsatellite (optional,
                 scalar, no default)
        -motif => the repeat motif of this microsatellite (optional,
                 scalar, no default)
        -repeats => the number of motif repeats for this microsatellite
                (optional, scalar, no default)
        -repeat_start_position => the starting position of the
                microsatellite in this sequence. The first base of the
                sequence is position "1". (optional, scalar, no default)

 Note    : Creating a Bio::Map::Microsatellite object with no position
        might be useful for microsatellite people wanting to embrace
        and extend this module. <raising hand> Me! Me! Me!
        - using repeat_start_position will trigger a mechinism to
        calculate a value for repeat_end_position. 


 Title   : motif
 Usage   : $o_usat->motif($new_motif);
               my $motif = $o_usat->motif();
 Function: Get/Set the repeat motif for this Microsatellite.
 Returns : A scalar representing the current repeat motif of this
 Args    : none to get, OR string to set


 Title   : sequence
 Usage   : $o_usat->sequence($new_sequence);
               my $sequence = $o_usat->sequence();
 Function: Get/Set the sequence for this Microsatellite.
 Returns : A scalar representing the current sequence of this
 Args    : none to get, OR string to set


 Title   : repeats
 Usage   : $o_usat->repeats($new_repeats);
               my $repeats = $o_usat->repeats()
 Function: Get/Set the repeat repeats for this Microsatellite.
 Returns : A scalar representing the current number of repeats of this
 Args    : none to get, OR int to set


 Title   : repeat_start_position
 Usage   : $o_usat->repeat_start_position($new_repeat_start_position);
               my $repeat_start_position = $o_usat->repeat_start_position();
 Function: Get/Set the repeat repeat_start_position for this
 Returns : A scalar representing the repeat start position for this 
 Args    : none to get, OR string to set
               This method will also try to set the repeat end position. This
               depends on having information for the motif and the number of
               repeats. If you want to use methods like get_trailing_flank or
               get_leading flank, be careful to include the right information.


 Title   : repeat_end_position
 Usage   : $o_usat->repeat_end_position("set");
               $current_repeat_end_position = $o_usat->repeat_end_position();
 Function: Get/set the end position of the repeat in this sequence.
 Returns : A scalar representing the base index of the end of the
               repeat in this Microsatellite. The first base in the sequence
               is base 1.
 Args    : A scalar representing a value, the string "set", or no
               argument (see Notes).
 Notes   : If you do not provide an argument to this method, the current
           end position of the repeat in this Microsatellite will be
           returned (a scalar).
           If you provide the string "set" to this method it will set the
           end position based on the start position, the length of the
           motif, and the number of repeats.
           If you specify a value the current end position of the repeat
           will be set to that value. This is a really bad idea. Don't do


 Title   : equals
 Usage   : if ($mappable->equals($mapable2)) {...}
 Function: Test if a position is equal to another position
 Returns : boolean
 Args    : Bio::Map::MappableI


 Title   : less_than
 Usage   : if ($mappable->less_than($m2)) {...}
 Function: Tests if a position is less than another position
 Returns : boolean
 Args    : Bio::Map::MappableI


 Title   : greater_than
 Usage   : if ($mappable->greater_than($m2)) {...}
 Function: Tests if position is greater than another position
 Returns : boolean
 Args    : Bio::Map::MappableI


 Title   : get_leading_flank
 Usage   : $leading_sequence = $o_usat->get_leading_flank();
 Returns : A scalar representing the sequence before the repeats in this
 Args    : none


 Title   : get_trailing_flank
 Usage   : $trailing_flank = $o_usat->get_trailing_flank();
 Returns : A scalar representing the sequence after the repeats in this
 Args    : none
syntax highlighting: