Christopher Fields > BioPerl-1.6.901 > Bio::SeqFeature::Primer



Annotate this POD


New  12
Open  4
View/Report Bugs
Module Version: 1.006901   Source   Latest Release: BioPerl-1.6.924


Bio::SeqFeature::Primer - Primer Generic SeqFeature


 # set up a single primer that can be used in a PCR reaction

 use Bio::SeqFeature::Primer;

 # initiate a primer with raw sequence
 my $primer=Bio::SeqFeature::Primer->new(-seq=>'CTTTTCATTCTGACTGCAACG');

 # get the primery tag for the primer # should return Primer
 my $tag=$primer->primary_tag;

 # get or set the location that the primer binds to the target at
 my $location=$primer->location(500);

 # get or set the 5' end of the primer homology, as the primer doesn't 
 # have to be the same as the target sequence
 my $start=$primer->start;

 # get or set the 3' end of the primer homology
 my $end = $primer->end;

 # get or set the strand of the primer. Strand should be 1, 0, or -1
 my $strand=$primer->strand;

 # get or set the id of the primer
 my $id=$primer->display_id;

 # get the tm of the primer. This is calculated for you by the software.
 # however, see the docs.
 my $tm = $primer->Tm;

 print "These are the details of the primer:\n\tTag:\t\t$tag\n\tLocation\t$location\n\tStart:\t\t$start\n";
 print "\tEnd:\t\t$end\n\tStrand:\t\t$strand\n\tID:\t\t$id\n\tTm:\t\t$tm\n";


Handle primer sequences. This will allow you to generate a primer object required for a Bio::Seq::PrimedSeq object. This module is designed to integrate with Bio::Tools::Primer3 and Bio::Seq::PrimedSeq.

In addition, you can calculate the melting temperature of the primer.

This module is supposed to implement location and range, presumably through, but does not do so yet. However, it does allow you to set primers, and use those objects as the basis for Bio::Seq::PrimedSeq objects.

See also the POD for Bio::Seq::PrimedSeq and Bio::Tools::Nucleotide::Analysis::Primer3


Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.                  - General discussion  - About the mailing lists


Please direct usage questions or support issues to the mailing list:

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:


Rob Edwards,

The original concept and much of the code was written by Chad Matsalla,


        The rest of the documentation details each of the object
        methods. Internal methods are usually preceded with a _


 Title   : new()
 Usage   : $primer = Bio::SeqFeature::Primer(-seq=>sequence_object);
 Function: Instantiate a new object
 Returns : A SeqPrimer object
 Args    : You must pass either a sequence object (preferable) or a sequence. 


 Title   : seq()
 Usage   : $seq = $primer->seq();
 Function: Return the sequence associated with this Primer. 
 Returns : A Bio::Seq object
 Args    : None.


 Title   : source_tag()
 Usage   : $tag = $feature->source_tag();
 Function: Returns the source of this tag.
 Returns : A string.
 Args    : If an argument is provided, the source of this SeqFeature
           is set to that argument.


 Title   : location()
 Usage   : $tag = $primer->location();
 Function: Gets or sets the location of the primer on the sequence  
 Returns : If the location is set, returns that, if not returns 0. 
           Note: At the moment I am using the primer3 notation of location
           (although you can set whatever you want). 
           In this form, both primers are given from their 5' ends and a length.
           In this case, the left primer is given from the leftmost end, but
           the right primer is given from the rightmost end.
           You can use start() and end() to get the leftmost and rightmost base
           of each sequence.
 Args    : If supplied will set a location


 Title   : start()
 Usage   : $start_position = $primer->start($new_position);
 Function: Return the start position of this Primer.
           This is the leftmost base, regardless of whether it is a left or right primer.
 Returns : The start position of this primer or 0 if not set.
 Args    : If supplied will set a start position.


 Title   : end()
 Usage   : $end_position = $primer->end($new_position);
 Function: Return the end position of this primer.
           This is the rightmost base, regardless of whether it is a left or right primer.
 Returns : The end position of this primer.
 Args    : If supplied will set an end position.


 Title   : strand()
 Usage   : $strand=$primer->strand()
 Function: Get or set the strand.
 Returns : The strand that the primer binds to.
 Args    :  If an argument is supplied will set the strand, otherwise will return it. Should be 1, 0 (not set), or -1


 Title   : display_id()
 Usage   : $id = $primer->display_id($new_id)
 Function: Returns the display ID for this Primer feature
 Returns : A scalar.
 Args    : If an argument is provided, the display_id of this primer is
           set to that value.


  Title   : Tm()
  Usage   : $tm = $primer->Tm(-salt=>'0.05', -oligo=>'0.0000001')
  Function: Calculates and returns the Tm (melting temperature) of the primer
  Returns : A scalar containing the Tm.
  Args    : -salt  : set the Na+ concentration on which to base the calculation
                     (default=0.05 molar).
          : -oligo : set the oligo concentration on which to base the
                     calculation (default=0.00000025 molar).
  Notes   : Calculation of Tm as per Allawi et. al Biochemistry 1997
            36:10581-10594. Also see documentation at
   as they use this
            formula and have a couple nice help pages. These Tm values will be
            about are about 0.5-3 degrees off from those of the idtdna web tool.
            I don't know why.

            This was suggested by Barry Moore (thanks!). See the discussion on
            the bioperl-l with the subject "Bio::SeqFeature::Primer Calculating
            the PrimerTM"


 Title   : Tm_estimate
 Usage   : $tm = $primer->Tm_estimate(-salt=>'0.05')
 Function: Calculates and returns the Tm (melting temperature) of the primer
 Returns : A scalar containing the Tm.
 Args    : -salt set the Na+ concentration on which to base the calculation.
 Notes   : This is an estimate of the Tm that is kept in for comparative reasons.
           You should probably use Tm instead!

           This Tm calculations are taken from the Primer3 docs: They are
           based on Bolton and McCarthy, PNAS 84:1390 (1962) 
           as presented in Sambrook, Fritsch and Maniatis,
           Molecular Cloning, p 11.46 (1989, CSHL Press).

           Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length

           where [Na+] is the molar sodium concentration, %GC is the
           %G+C of the sequence, and length is the length of the sequence.

           However.... I can never get this calculation to give me the same result
           as primer3 does. Don't ask why, I never figured it out. But I did 
           want to include a Tm calculation here because I use these modules for 
           other things besides reading primer3 output.

           The primer3 calculation is saved as 'PRIMER_LEFT_TM' or 'PRIMER_RIGHT_TM'
           and this calculation is saved as $primer->Tm so you can get both and
           average them!
syntax highlighting: